Incidental Mutation 'R7507:Olfr1509'
ID581864
Institutional Source Beutler Lab
Gene Symbol Olfr1509
Ensembl Gene ENSMUSG00000035626
Gene Nameolfactory receptor 1509
SynonymsMOR244-3, MOR83, GA_x6K02T2RJGY-534312-533386
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52442990-52452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52450473 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 20 (N20S)
Ref Sequence ENSEMBL: ENSMUSP00000145819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045066] [ENSMUST00000205900] [ENSMUST00000206100] [ENSMUST00000206437] [ENSMUST00000206718] [ENSMUST00000215030]
Predicted Effect probably null
Transcript: ENSMUST00000045066
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046688
Gene: ENSMUSG00000035626
AA Change: N20S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-6 PFAM
Pfam:7tm_1 41 287 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205900
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000206100
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000206437
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000206718
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000215030
AA Change: N20S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Olfr1509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1509 APN 14 52451027 missense probably benign 0.00
IGL01694:Olfr1509 APN 14 52450584 missense probably benign
IGL02656:Olfr1509 APN 14 52450709 missense possibly damaging 0.60
R0244:Olfr1509 UTSW 14 52450512 missense probably benign 0.00
R1249:Olfr1509 UTSW 14 52450522 missense probably benign
R1601:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R1717:Olfr1509 UTSW 14 52450839 missense probably benign 0.00
R1953:Olfr1509 UTSW 14 52450887 missense probably benign 0.00
R4689:Olfr1509 UTSW 14 52451214 missense probably benign
R4943:Olfr1509 UTSW 14 52450594 nonsense probably null
R6223:Olfr1509 UTSW 14 52450679 missense probably benign 0.00
R6516:Olfr1509 UTSW 14 52451129 missense probably damaging 1.00
R7323:Olfr1509 UTSW 14 52451213 missense probably benign 0.00
R7674:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
Z1088:Olfr1509 UTSW 14 52451209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATATTCATGCCAAGCCTCAAAG -3'
(R):5'- GCAATTGTCAAAGGAAATGGTCTTC -3'

Sequencing Primer
(F):5'- GCCTCAAAGAAAAACAGTCATTTC -3'
(R):5'- TCAAGCATCTTGGGCACG -3'
Posted On2019-10-17