Incidental Mutation 'R7507:Vasn'
ID 581865
Institutional Source Beutler Lab
Gene Symbol Vasn
Ensembl Gene ENSMUSG00000039646
Gene Name vasorin
Synonyms ATIA, Slitl2, 2610528G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock # R7507 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 4639941-4650802 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4649481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 431 (C431R)
Ref Sequence ENSEMBL: ENSMUSP00000045162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000038770] [ENSMUST00000090480] [ENSMUST00000135823]
AlphaFold Q9CZT5
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038770
AA Change: C431R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045162
Gene: ENSMUSG00000039646
AA Change: C431R

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
LRRNT 24 57 4.05e-5 SMART
LRR_TYP 76 99 8.15e-6 SMART
LRR_TYP 100 123 6.23e-2 SMART
LRR_TYP 124 147 6.42e-4 SMART
LRR 169 192 1.99e0 SMART
low complexity region 197 206 N/A INTRINSIC
LRR 216 238 6.22e0 SMART
LRR 239 263 1.16e2 SMART
LRR 264 287 1.15e1 SMART
LRRCT 299 351 2.03e-11 SMART
EGF 409 443 2.79e-4 SMART
FN3 460 544 2.72e-3 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to TNFalpha-induced lethality, TNFalpha-, cycloheximide-, or CoCl2-induced cell death, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Vasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vasn APN 16 4648368 missense probably benign 0.00
IGL01543:Vasn APN 16 4649892 missense possibly damaging 0.60
PIT4243001:Vasn UTSW 16 4649616 missense probably damaging 1.00
PIT4810001:Vasn UTSW 16 4650045 missense probably benign
R1394:Vasn UTSW 16 4649712 nonsense probably null
R1459:Vasn UTSW 16 4648609 splice site probably null
R2136:Vasn UTSW 16 4649795 nonsense probably null
R4482:Vasn UTSW 16 4648326 missense possibly damaging 0.87
R5423:Vasn UTSW 16 4648420 missense probably benign 0.01
R5733:Vasn UTSW 16 4650162 missense possibly damaging 0.93
R7230:Vasn UTSW 16 4649622 missense probably benign 0.10
R8261:Vasn UTSW 16 4648296 missense probably damaging 0.97
R8858:Vasn UTSW 16 4648969 missense probably benign 0.34
R9083:Vasn UTSW 16 4650007 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACACTTTCAACTTCTAGCCAAGCTC -3'
(R):5'- ACAGGTTGCGATAGGTGAGC -3'

Sequencing Primer
(F):5'- TAGCCAAGCTCCCACCTGG -3'
(R):5'- TGCACAGTGTTACCCTGCAAG -3'
Posted On 2019-10-17