Incidental Mutation 'R7507:Vasn'
ID581865
Institutional Source Beutler Lab
Gene Symbol Vasn
Ensembl Gene ENSMUSG00000039646
Gene Namevasorin
SynonymsATIA, Slitl2, 2610528G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4639941-4650802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4649481 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 431 (C431R)
Ref Sequence ENSEMBL: ENSMUSP00000045162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000038770] [ENSMUST00000090480] [ENSMUST00000135823]
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038770
AA Change: C431R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045162
Gene: ENSMUSG00000039646
AA Change: C431R

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
LRRNT 24 57 4.05e-5 SMART
LRR_TYP 76 99 8.15e-6 SMART
LRR_TYP 100 123 6.23e-2 SMART
LRR_TYP 124 147 6.42e-4 SMART
LRR 169 192 1.99e0 SMART
low complexity region 197 206 N/A INTRINSIC
LRR 216 238 6.22e0 SMART
LRR 239 263 1.16e2 SMART
LRR 264 287 1.15e1 SMART
LRRCT 299 351 2.03e-11 SMART
EGF 409 443 2.79e-4 SMART
FN3 460 544 2.72e-3 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to TNFalpha-induced lethality, TNFalpha-, cycloheximide-, or CoCl2-induced cell death, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Vasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vasn APN 16 4648368 missense probably benign 0.00
IGL01543:Vasn APN 16 4649892 missense possibly damaging 0.60
PIT4243001:Vasn UTSW 16 4649616 missense probably damaging 1.00
PIT4810001:Vasn UTSW 16 4650045 missense probably benign
R1394:Vasn UTSW 16 4649712 nonsense probably null
R1459:Vasn UTSW 16 4648609 splice site probably null
R2136:Vasn UTSW 16 4649795 nonsense probably null
R4482:Vasn UTSW 16 4648326 missense possibly damaging 0.87
R5423:Vasn UTSW 16 4648420 missense probably benign 0.01
R5733:Vasn UTSW 16 4650162 missense possibly damaging 0.93
R7230:Vasn UTSW 16 4649622 missense probably benign 0.10
R8261:Vasn UTSW 16 4648296 missense probably damaging 0.97
R8858:Vasn UTSW 16 4648969 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACACTTTCAACTTCTAGCCAAGCTC -3'
(R):5'- ACAGGTTGCGATAGGTGAGC -3'

Sequencing Primer
(F):5'- TAGCCAAGCTCCCACCTGG -3'
(R):5'- TGCACAGTGTTACCCTGCAAG -3'
Posted On2019-10-17