Incidental Mutation 'R7507:Tubb4a'
ID581867
Institutional Source Beutler Lab
Gene Symbol Tubb4a
Ensembl Gene ENSMUSG00000062591
Gene Nametubulin, beta 4A class IVA
SynonymsTubb, Tubb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57080066-57087782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57081642 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 128 (D128G)
Ref Sequence ENSEMBL: ENSMUSP00000071135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071135]
Predicted Effect probably benign
Transcript: ENSMUST00000011623
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071135
AA Change: D128G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591
AA Change: D128G

DomainStartEndE-ValueType
Tubulin 47 244 4.45e-67 SMART
Tubulin_C 246 383 5.5e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Meta Mutation Damage Score 0.7862 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelinating leukodystrophy-6 and autosomal dominant torsion dystonia-4. Alternate splicing results in multiple transcript variants encoding different isoforms. A pseudogene of this gene is found on chromosome X. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Tubb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Tubb4a APN 17 57086072 missense probably benign 0.24
IGL02343:Tubb4a APN 17 57081538 missense probably benign
IGL02562:Tubb4a APN 17 57081163 nonsense probably null
G1citation:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
P0022:Tubb4a UTSW 17 57081538 missense probably benign
R0043:Tubb4a UTSW 17 57081114 missense probably damaging 1.00
R0195:Tubb4a UTSW 17 57081499 missense probably damaging 1.00
R0309:Tubb4a UTSW 17 57081182 nonsense probably null
R0348:Tubb4a UTSW 17 57080770 missense probably damaging 0.98
R2440:Tubb4a UTSW 17 57086285 missense probably damaging 1.00
R2762:Tubb4a UTSW 17 57080974 missense probably benign
R3927:Tubb4a UTSW 17 57080967 missense probably benign 0.00
R6284:Tubb4a UTSW 17 57080833 missense probably damaging 1.00
R6351:Tubb4a UTSW 17 57081016 missense probably damaging 1.00
R6760:Tubb4a UTSW 17 57080796 missense possibly damaging 0.82
R6822:Tubb4a UTSW 17 57080904 missense probably damaging 0.99
R7381:Tubb4a UTSW 17 57080698 missense unknown
R7892:Tubb4a UTSW 17 57080880 nonsense probably null
RF013:Tubb4a UTSW 17 57087464 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGTGTTCTCCACCAGCTG -3'
(R):5'- TCAGATACCAGGGTGCAGTG -3'

Sequencing Primer
(F):5'- CAGACAGTGTGGCATTGTAGG -3'
(R):5'- TACCAGGGTGCAGTGCAGATG -3'
Posted On2019-10-17