Incidental Mutation 'R7507:Rasgrp3'
ID581868
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene NameRAS, guanyl releasing protein 3
SynonymsLOC240168
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location75435905-75529043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75497060 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 119 (D119E)
Ref Sequence ENSEMBL: ENSMUSP00000092828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
Predicted Effect probably damaging
Transcript: ENSMUST00000095204
AA Change: D119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: D119E

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164192
AA Change: D119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: D119E

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Meta Mutation Damage Score 0.4055 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75500139 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75524177 missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75500758 critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75500173 missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R4927:Rasgrp3 UTSW 17 75516355 missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75516416 missense possibly damaging 0.48
R7536:Rasgrp3 UTSW 17 75514133 missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75496416 missense probably benign
R8089:Rasgrp3 UTSW 17 75497061 missense possibly damaging 0.54
R8677:Rasgrp3 UTSW 17 75512060 missense probably benign 0.00
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Z1177:Rasgrp3 UTSW 17 75512095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTTCCAGCTGTCAAAAGTCC -3'
(R):5'- CATGATCTGAGTAGCAAGAGCATAG -3'

Sequencing Primer
(F):5'- GTTTGATTCGCATGACTGAG -3'
(R):5'- GCATAGGAGACATTGACTACATTCAG -3'
Posted On2019-10-17