Mutagenetix > Incidental Mutations

Incidental Mutation 'R0008:Ass1'

58187

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

038303-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0008 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31514819 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 371 (N371Y)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.9349

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

98% (109/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 138,176,585	K118R	possibly damaging	Het
Adtrp	T	C	13: 41,767,465	T88A	probably damaging	Het
Afap1l1	A	G	18: 61,756,905	S87P	probably benign	Het
Ankrd27	A	G	7: 35,603,700	K196R	probably benign	Het
Apoe	G	A	7: 19,697,080	T79M	probably damaging	Het
Arrdc3	T	A	13: 80,883,892	Y81*	probably null	Het
Arrdc3	T	A	13: 80,891,075	I75N	probably damaging	Het
Asah2	T	A	19: 32,003,731	K629*	probably null	Het
C130074G19Rik	A	G	1: 184,882,922	S24P	probably benign	Het
C87436	A	G	6: 86,446,283		probably benign	Het
Calcrl	T	C	2: 84,373,274	D54G	probably benign	Het
Clcn2	T	C	16: 20,710,390	N367S	probably null	Het
Cnot1	G	T	8: 95,761,341	D562E	probably damaging	Het
Commd6	G	A	14: 101,640,273		probably benign	Het
Cox6a2	G	A	7: 128,206,040		probably benign	Het
Cp	T	A	3: 19,968,123	Y230N	probably damaging	Het
Dclre1c	T	C	2: 3,437,995	V64A	probably damaging	Het
Eng	T	C	2: 32,677,680	V110A	probably damaging	Het
Esyt3	T	C	9: 99,338,807	I114M	possibly damaging	Het
Fam83h	A	T	15: 76,003,962	Y509N	probably damaging	Het
Fat2	A	T	11: 55,311,249	L333H	probably damaging	Het
Fbxo21	A	G	5: 118,008,013	N567S	possibly damaging	Het
Fn1	A	T	1: 71,595,720	L1964Q	probably damaging	Het
Fuk	T	C	8: 110,884,233		probably benign	Het
Gorasp1	G	T	9: 119,928,246	S353R	possibly damaging	Het
Grk2	C	T	19: 4,287,234	E646K	probably damaging	Het
Hoxc11	T	C	15: 102,954,962	V146A	probably damaging	Het
Igf2bp2	T	C	16: 22,076,091	T301A	probably benign	Het
Il11	T	C	7: 4,773,659	S111G	probably benign	Het
Ist1	A	T	8: 109,676,786	I273K	probably benign	Het
Kdm2b	G	A	5: 122,881,743	S738L	probably benign	Het
Lrp2	T	A	2: 69,516,551	N784Y	probably benign	Het
Lrp6	T	C	6: 134,485,753	E648G	probably damaging	Het
Mapk15	G	A	15: 75,998,254	E408K	probably benign	Het
Mdn1	T	A	4: 32,718,317	F2191I	possibly damaging	Het
Metrn	C	A	17: 25,796,505	V79F	possibly damaging	Het
Mtbp	T	A	15: 55,586,493		probably benign	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myo3a	T	A	2: 22,579,741	I508N	probably damaging	Het
Nat9	A	T	11: 115,185,115	Y27N	probably damaging	Het
Ncapg2	T	C	12: 116,429,835	F553S	probably damaging	Het
Nipsnap3b	T	A	4: 53,015,112	L53Q	probably damaging	Het
Nlrp3	A	T	11: 59,558,448	H852L	probably benign	Het
Olfr1251	T	A	2: 89,667,084	K267N	probably damaging	Het
Olfr1484	A	G	19: 13,585,876	I191V	probably benign	Het
Olfr1532-ps1	A	G	7: 106,915,019	I274V	probably benign	Het
Olfr594	A	T	7: 103,220,351	D211V	probably damaging	Het
Olfr594	G	A	7: 103,220,377	A220T	probably benign	Het
Olfr720	T	A	14: 14,176,092		probably benign	Het
Pax9	A	G	12: 56,709,743	T289A	probably benign	Het
Pcyt2	A	T	11: 120,615,869	I53N	possibly damaging	Het
Pdlim4	C	T	11: 54,055,049	V327M	probably damaging	Het
Pdzph1	T	A	17: 58,922,761		probably benign	Het
Plekhm2	C	T	4: 141,642,393		probably benign	Het
Ppt1	T	C	4: 122,848,423		probably benign	Het
Prdm1	C	T	10: 44,441,679	E398K	probably damaging	Het
Prep	T	C	10: 45,115,078	V280A	probably benign	Het
Prkdc	T	A	16: 15,708,701		probably benign	Het
Proser3	G	A	7: 30,540,138	R514C	probably damaging	Het
Ptk7	G	A	17: 46,572,762		probably benign	Het
Rbm45	T	C	2: 76,378,398	Y293H	probably damaging	Het
Rnf213	A	C	11: 119,465,052	E4108A	possibly damaging	Het
Sdk2	A	G	11: 113,856,755	L643P	probably damaging	Het
Sec24d	C	A	3: 123,350,876		probably benign	Het
Sh2d3c	C	G	2: 32,753,021	H587D	probably damaging	Het
Slc1a1	G	A	19: 28,901,484	G208S	probably benign	Het
Slc35b4	A	T	6: 34,158,517	Y287N	probably damaging	Het
Slc46a2	T	A	4: 59,914,544	L126F	probably damaging	Het
Slc4a8	T	C	15: 100,800,493	M621T	possibly damaging	Het
Slc9b2	T	A	3: 135,336,508	V516D	possibly damaging	Het
Slco1a6	T	A	6: 142,157,222		probably benign	Het
Sncg	C	T	14: 34,374,538	V15I	probably benign	Het
Srgap2	T	C	1: 131,355,564	T260A	probably damaging	Het
Stk10	T	A	11: 32,587,305		probably benign	Het
Taf5	A	G	19: 47,075,862	S415G	possibly damaging	Het
Tdp1	C	T	12: 99,954,958		probably benign	Het
Tdp2	T	G	13: 24,841,350		probably null	Het
Tgfbi	T	A	13: 56,629,774	I357N	probably benign	Het
Tmem116	A	G	5: 121,495,096	T178A	probably damaging	Het
Tnrc6a	G	A	7: 123,170,394	R469H	probably benign	Het
Top2a	A	T	11: 99,002,903	L1055*	probably null	Het
Tox	T	A	4: 6,842,411	M40L	probably benign	Het
Trib2	A	T	12: 15,809,929	H110Q	probably benign	Het
Trpa1	A	G	1: 14,903,215	I293T	possibly damaging	Het
Trpv2	A	G	11: 62,590,260	Y395C	probably damaging	Het
Ubn2	T	A	6: 38,434,600		probably null	Het
Ubr4	C	T	4: 139,430,176	T2348M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn1r33	C	A	6: 66,612,526	G15*	probably null	Het
Vmn1r37	T	A	6: 66,731,785	S95T	probably benign	Het
Vmn2r57	A	G	7: 41,400,652	C558R	probably damaging	Het
Vnn1	T	C	10: 23,898,602		probably null	Het
Vps13c	T	C	9: 67,919,262	V1395A	probably benign	Het
Vwa7	A	G	17: 35,019,805	I290V	probably benign	Het
Wdr93	A	G	7: 79,758,473	E234G	probably damaging	Het
Zfp385b	A	T	2: 77,415,947	S245R	probably benign	Het
Zfp942	A	T	17: 21,928,338	C437S	probably damaging	Het
Zfyve9	T	A	4: 108,718,705	E393V	possibly damaging	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGTAAGGCAGAACCGAGCCTATCAG -3'
(R):5'- TGCGCCACAGCCTAACTTTTATACC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'

Posted On

2013-07-11