Incidental Mutation 'R7508:Sgo2a'
ID581872
Institutional Source Beutler Lab
Gene Symbol Sgo2a
Ensembl Gene ENSMUSG00000026039
Gene Nameshugoshin 2A
SynonymsSgol2a, Sgol2, 1110007N04Rik, D1Ertd8e, 5730576N04Rik, Tripin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location57995971-58025899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58017795 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1046 (K1046R)
Ref Sequence ENSEMBL: ENSMUSP00000027202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027202] [ENSMUST00000163061]
Predicted Effect probably benign
Transcript: ENSMUST00000027202
AA Change: K1046R

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027202
Gene: ENSMUSG00000026039
AA Change: K1046R

DomainStartEndE-ValueType
coiled coil region 54 109 N/A INTRINSIC
low complexity region 182 198 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 396 431 N/A INTRINSIC
low complexity region 583 597 N/A INTRINSIC
low complexity region 718 729 N/A INTRINSIC
low complexity region 1068 1078 N/A INTRINSIC
low complexity region 1112 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163061
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with abnormalities in meiosis but not in mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Sgo2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Sgo2a APN 1 58016594 missense probably damaging 1.00
IGL00534:Sgo2a APN 1 58016344 missense probably damaging 1.00
IGL00902:Sgo2a APN 1 58016099 missense probably benign 0.00
IGL01571:Sgo2a APN 1 58017974 missense probably damaging 0.99
IGL02268:Sgo2a APN 1 58017722 missense probably benign 0.10
IGL02756:Sgo2a APN 1 58016350 missense probably damaging 1.00
IGL02887:Sgo2a APN 1 58016352 missense probably damaging 0.99
IGL02991:Sgo2a APN 1 58015355 intron probably benign
harpo UTSW 1 58019660 nonsense probably null
mashugana UTSW 1 58016567 missense probably damaging 1.00
meshugas UTSW 1 58002933 nonsense probably null
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0095:Sgo2a UTSW 1 58015555 missense probably benign 0.11
R0325:Sgo2a UTSW 1 58016697 missense probably benign
R0464:Sgo2a UTSW 1 58000094 missense probably damaging 0.98
R0699:Sgo2a UTSW 1 57998149 nonsense probably null
R1251:Sgo2a UTSW 1 57999962 critical splice acceptor site probably null
R1355:Sgo2a UTSW 1 58017965 missense possibly damaging 0.91
R1457:Sgo2a UTSW 1 58015806 missense probably benign 0.00
R2244:Sgo2a UTSW 1 58017054 missense probably benign 0.00
R3896:Sgo2a UTSW 1 58013646 missense probably damaging 0.99
R4919:Sgo2a UTSW 1 57998134 missense probably damaging 0.99
R5030:Sgo2a UTSW 1 58017759 nonsense probably null
R5123:Sgo2a UTSW 1 58016567 missense probably damaging 1.00
R5317:Sgo2a UTSW 1 58015524 missense probably benign
R5767:Sgo2a UTSW 1 58019660 nonsense probably null
R5844:Sgo2a UTSW 1 58016397 missense probably damaging 0.99
R6018:Sgo2a UTSW 1 58016959 missense probably benign 0.01
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6450:Sgo2a UTSW 1 58002933 nonsense probably null
R6998:Sgo2a UTSW 1 58016640 missense probably damaging 0.99
R7073:Sgo2a UTSW 1 58017785 missense possibly damaging 0.73
R7722:Sgo2a UTSW 1 58016537 missense probably benign 0.45
R8094:Sgo2a UTSW 1 58017141 missense possibly damaging 0.77
X0065:Sgo2a UTSW 1 58016358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGCTCCCTCTCGGTTG -3'
(R):5'- TAAAACTCTGGCCTACCCGGTG -3'

Sequencing Primer
(F):5'- TGTTCTCCTGAAACCCACGGG -3'
(R):5'- ACCCGGTGTCGACTTCTGTG -3'
Posted On2019-10-17