Incidental Mutation 'R7508:Rnpep'
ID581877
Institutional Source Beutler Lab
Gene Symbol Rnpep
Ensembl Gene ENSMUSG00000041926
Gene Namearginyl aminopeptidase (aminopeptidase B)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135262712-135284084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135278858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 166 (V166A)
Ref Sequence ENSEMBL: ENSMUSP00000076564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074357] [ENSMUST00000077340]
Predicted Effect probably benign
Transcript: ENSMUST00000074357
AA Change: V166A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073962
Gene: ENSMUSG00000041926
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:Peptidase_M1 31 246 2.5e-33 PFAM
Pfam:Peptidase_M1 243 378 3.1e-36 PFAM
Pfam:Peptidase_MA_2 257 402 4.5e-21 PFAM
Leuk-A4-hydro_C 461 606 1.4e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077340
AA Change: V166A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076564
Gene: ENSMUSG00000041926
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:Peptidase_M1 31 417 2.2e-84 PFAM
Leuk-A4-hydro_C 500 645 1.4e-55 SMART
Meta Mutation Damage Score 0.4451 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Rnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01789:Rnpep APN 1 135268095 missense possibly damaging 0.72
R0001:Rnpep UTSW 1 135272485 splice site probably benign
R0498:Rnpep UTSW 1 135265352 missense probably damaging 1.00
R0597:Rnpep UTSW 1 135272419 missense probably damaging 0.99
R1728:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1728:Rnpep UTSW 1 135283977 missense probably benign
R1729:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1729:Rnpep UTSW 1 135283977 missense probably benign
R1730:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1739:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1739:Rnpep UTSW 1 135283629 missense probably benign
R1762:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1783:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1783:Rnpep UTSW 1 135283977 missense probably benign
R1784:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1785:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1785:Rnpep UTSW 1 135283977 missense probably benign
R2101:Rnpep UTSW 1 135271617 missense probably damaging 1.00
R4933:Rnpep UTSW 1 135267026 intron probably benign
R4993:Rnpep UTSW 1 135263032 missense possibly damaging 0.80
R5642:Rnpep UTSW 1 135277521 missense probably damaging 0.99
R6965:Rnpep UTSW 1 135263120 nonsense probably null
R7143:Rnpep UTSW 1 135283749 missense probably benign 0.41
R8060:Rnpep UTSW 1 135266920 missense probably damaging 1.00
R8094:Rnpep UTSW 1 135283776 missense probably damaging 1.00
R8191:Rnpep UTSW 1 135272434 missense possibly damaging 0.56
R8300:Rnpep UTSW 1 135283659 missense probably benign 0.00
Z1176:Rnpep UTSW 1 135271755 missense probably benign 0.19
Z1176:Rnpep UTSW 1 135283836 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGATGGGTCTGAAGGTACGTCC -3'
(R):5'- ACAGAGTGATCCTCAGAAAGGTC -3'

Sequencing Primer
(F):5'- AGACATGTACTACTGTACCTGGC -3'
(R):5'- GAGTGATCCTCAGAAAGGTCTTAATG -3'
Posted On2019-10-17