Incidental Mutation 'R7508:Pik3cd'
ID581886
Institutional Source Beutler Lab
Gene Symbol Pik3cd
Ensembl Gene ENSMUSG00000039936
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms2410099E07Rik, p110delta, 2610208K16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location149649168-149702571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149654583 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 667 (F667L)
Ref Sequence ENSEMBL: ENSMUSP00000101315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038859
AA Change: F664L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: F664L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 776 1042 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105688
AA Change: F664L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: F664L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 685 8.56e-87 SMART
PI3Kc 775 1041 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105689
AA Change: F663L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: F663L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 684 1.35e-84 SMART
PI3Kc 774 1040 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105690
AA Change: F667L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: F667L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118704
AA Change: F666L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: F666L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 687 1.8e-80 SMART
PI3Kc 777 1043 5.65e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122059
AA Change: F660L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: F660L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 408 6.47e-23 SMART
PI3Ka 492 681 8.56e-87 SMART
PI3Kc 771 1037 5.65e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177654
AA Change: F667L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: F667L

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Pik3cd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense possibly damaging 0.82
IGL02794:Pik3cd APN 4 149654571 missense probably benign
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
stinger UTSW 4 149657319 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably damaging 1.00
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.02
R1796:Pik3cd UTSW 4 149654119 missense possibly damaging 0.83
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 1.00
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
R6282:Pik3cd UTSW 4 149659743 missense probably benign 0.00
R6453:Pik3cd UTSW 4 149652302 missense probably damaging 1.00
R7286:Pik3cd UTSW 4 149659714 missense probably benign 0.08
R7423:Pik3cd UTSW 4 149651763 critical splice donor site probably null
R7665:Pik3cd UTSW 4 149654050 missense possibly damaging 0.70
R7897:Pik3cd UTSW 4 149657269 missense probably benign 0.06
R8039:Pik3cd UTSW 4 149659866 missense possibly damaging 0.91
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.04
Z1176:Pik3cd UTSW 4 149654847 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGCTTGCTCAGTGCTTCC -3'
(R):5'- TCCTATGAGGGTCACGGTGAAG -3'

Sequencing Primer
(F):5'- CCCCCTGGTGGTGATAATG -3'
(R):5'- TCACGGTGAAGTGAGAACTC -3'
Posted On2019-10-17