Incidental Mutation 'R7508:Fam13a'
ID581891
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Namefamily with sequence similarity 13, member A
SynonymsD430015B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58932090-59024549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58987284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 54 (D54E)
Ref Sequence ENSEMBL: ENSMUSP00000087304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
Predicted Effect probably damaging
Transcript: ENSMUST00000089860
AA Change: D54E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709
AA Change: D54E

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173193
AA Change: D54E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709
AA Change: D54E

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58946126 missense probably benign 0.03
IGL00467:Fam13a APN 6 58940113 splice site probably benign
IGL01288:Fam13a APN 6 58956727 missense probably damaging 1.00
IGL01503:Fam13a APN 6 58956080 missense probably damaging 1.00
IGL01532:Fam13a APN 6 58940295 missense probably damaging 0.96
IGL02197:Fam13a APN 6 58935601 missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58987219 missense probably benign 0.00
IGL03189:Fam13a APN 6 58956858 missense probably damaging 0.99
BB009:Fam13a UTSW 6 58983888 critical splice donor site probably null
BB019:Fam13a UTSW 6 58983888 critical splice donor site probably null
R0361:Fam13a UTSW 6 58987174 missense probably benign
R0512:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R0801:Fam13a UTSW 6 58984012 missense probably benign 0.01
R1222:Fam13a UTSW 6 58935722 splice site probably benign
R1378:Fam13a UTSW 6 58956751 missense probably benign 0.04
R1535:Fam13a UTSW 6 58939347 missense probably damaging 0.99
R1614:Fam13a UTSW 6 58940184 missense probably damaging 1.00
R1663:Fam13a UTSW 6 58954372 nonsense probably null
R1809:Fam13a UTSW 6 58965060 critical splice donor site probably null
R1905:Fam13a UTSW 6 58953490 missense probably damaging 1.00
R2568:Fam13a UTSW 6 58935609 missense probably damaging 1.00
R3771:Fam13a UTSW 6 58987186 missense probably benign 0.11
R4654:Fam13a UTSW 6 58987167 missense probably benign
R5244:Fam13a UTSW 6 58953474 nonsense probably null
R5488:Fam13a UTSW 6 59024318 missense probably null 1.00
R5489:Fam13a UTSW 6 59024318 missense probably null 1.00
R5712:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R5729:Fam13a UTSW 6 58939307 missense probably damaging 0.99
R5969:Fam13a UTSW 6 58965198 missense probably damaging 1.00
R6074:Fam13a UTSW 6 58989738 splice site probably null
R6275:Fam13a UTSW 6 58954257 missense probably damaging 0.98
R6306:Fam13a UTSW 6 58940254 missense probably benign 0.02
R6338:Fam13a UTSW 6 58953499 missense probably damaging 1.00
R6603:Fam13a UTSW 6 58987189 missense probably benign 0.31
R7516:Fam13a UTSW 6 58955263 missense probably damaging 1.00
R7688:Fam13a UTSW 6 58935707 missense probably benign 0.05
R7728:Fam13a UTSW 6 58954299 missense possibly damaging 0.79
R7932:Fam13a UTSW 6 58983888 critical splice donor site probably null
R8080:Fam13a UTSW 6 58956805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGCTAAGTTAAGAATGATC -3'
(R):5'- ACCTACAGTGTTATCTACTACACAAGG -3'

Sequencing Primer
(F):5'- CTGACTGACTTTAAACAGAGAATCTC -3'
(R):5'- GGAAAGATTATCAGACACCACAAGGC -3'
Posted On2019-10-17