Incidental Mutation 'R7508:Vmn2r32'
ID 581893
Institutional Source Beutler Lab
Gene Symbol Vmn2r32
Ensembl Gene ENSMUSG00000096743
Gene Name vomeronasal 2, receptor 32
Synonyms V2r5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R7508 (G1)
Quality Score 121.008
Status Not validated
Chromosome 7
Chromosomal Location 7463015-7479973 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7467374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 515 (V515M)
Ref Sequence ENSEMBL: ENSMUSP00000092462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094866]
AlphaFold K7N686
Predicted Effect possibly damaging
Transcript: ENSMUST00000094866
AA Change: V515M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092462
Gene: ENSMUSG00000096743
AA Change: V515M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 3.6e-33 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 9.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Vmn2r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Vmn2r32 APN 7 7476697 missense probably damaging 0.97
IGL02333:Vmn2r32 APN 7 7464144 missense probably damaging 1.00
IGL02406:Vmn2r32 APN 7 7476710 missense probably benign
IGL02428:Vmn2r32 APN 7 7474284 missense probably benign 0.02
IGL02484:Vmn2r32 APN 7 7464117 missense probably damaging 1.00
IGL03277:Vmn2r32 APN 7 7474252 missense probably benign 0.23
IGL03366:Vmn2r32 APN 7 7464030 missense probably damaging 0.99
R1055:Vmn2r32 UTSW 7 7474327 nonsense probably null
R1695:Vmn2r32 UTSW 7 7463992 missense probably benign 0.01
R2172:Vmn2r32 UTSW 7 7474615 missense probably damaging 0.99
R2262:Vmn2r32 UTSW 7 7474619 missense probably benign
R3150:Vmn2r32 UTSW 7 7472555 missense probably benign
R4362:Vmn2r32 UTSW 7 7479858 nonsense probably null
R4432:Vmn2r32 UTSW 7 7479919 missense probably damaging 0.98
R4851:Vmn2r32 UTSW 7 7479954 missense possibly damaging 0.59
R4949:Vmn2r32 UTSW 7 7464084 missense probably benign 0.22
R5990:Vmn2r32 UTSW 7 7479810 missense probably damaging 0.97
R6083:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6084:Vmn2r32 UTSW 7 7464210 missense probably benign 0.15
R6116:Vmn2r32 UTSW 7 7464093 missense probably damaging 1.00
R6263:Vmn2r32 UTSW 7 7476692 missense possibly damaging 0.90
R6889:Vmn2r32 UTSW 7 7472574 missense possibly damaging 0.82
R7286:Vmn2r32 UTSW 7 7479808 missense probably benign 0.21
R7390:Vmn2r32 UTSW 7 7479852 missense probably benign 0.00
R7412:Vmn2r32 UTSW 7 7474213 missense possibly damaging 0.53
R8812:Vmn2r32 UTSW 7 7474670 missense probably damaging 1.00
R8968:Vmn2r32 UTSW 7 7474205 missense probably benign 0.00
R9331:Vmn2r32 UTSW 7 7464403 nonsense probably null
R9358:Vmn2r32 UTSW 7 7474198 missense probably damaging 1.00
Z1177:Vmn2r32 UTSW 7 7474161 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACTTCATTATTCCAGGGTGATG -3'
(R):5'- ACCAGGTTGCAACTTCTGTAG -3'

Sequencing Primer
(F):5'- TGGAAGAGAAATACATATCTTCGGG -3'
(R):5'- TAATCCCAGCACTTTGGAGG -3'
Posted On 2019-10-17