Incidental Mutation 'R7508:Lyl1'
ID581896
Institutional Source Beutler Lab
Gene Symbol Lyl1
Ensembl Gene ENSMUSG00000034041
Gene Namelymphoblastomic leukemia 1
SynonymsLyl-1, bHLHa18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score161.009
Status Validated
Chromosome8
Chromosomal Location84701457-84704715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84704300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 277 (V277A)
Ref Sequence ENSEMBL: ENSMUSP00000046010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037165
AA Change: V277A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041
AA Change: V277A

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076715
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099070
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109767
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109768
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125370
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136423
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a basic helix-loop-helix transcription factor. The encoded protein may play roles in blood vessel maturation and hematopoeisis. A translocation between this locus and the T cell receptor beta locus (GeneID 6957) on chromosome 7 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice with mutation of this gene are vaible and fertile. Defects in production and differentiation of progenitor cells are observed, along with impaired ability of fetal liver or bone marrow cells in reconstituting B and T lineages after transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Lyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Lyl1 APN 8 84702686 missense possibly damaging 0.46
IGL02948:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL02976:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03037:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03038:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03061:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03106:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03115:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03146:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03152:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03166:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03175:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03221:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03226:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03296:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03346:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03014:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03050:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03134:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
R3944:Lyl1 UTSW 8 84704002 missense probably damaging 1.00
R4752:Lyl1 UTSW 8 84704281 missense probably benign 0.17
R8139:Lyl1 UTSW 8 84702847 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATAGGCTTCCTGGTGCGG -3'
(R):5'- AAGCCACTGCAAGTAGCCTG -3'

Sequencing Primer
(F):5'- AAACGGCTGTGCTGACCTC -3'
(R):5'- CTGCAAGTAGCCTGTGGGAG -3'
Posted On2019-10-17