Incidental Mutation 'R7508:Tbc1d9b'
ID581904
Institutional Source Beutler Lab
Gene Symbol Tbc1d9b
Ensembl Gene ENSMUSG00000036644
Gene NameTBC1 domain family, member 9B
Synonyms2700008N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50131396-50172785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50145120 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 148 (F148L)
Ref Sequence ENSEMBL: ENSMUSP00000090825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093138] [ENSMUST00000101270]
Predicted Effect probably damaging
Transcript: ENSMUST00000093138
AA Change: F148L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090825
Gene: ENSMUSG00000036644
AA Change: F148L

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 2e-28 BLAST
low complexity region 1124 1138 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101270
AA Change: F148L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098828
Gene: ENSMUSG00000036644
AA Change: F148L

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
GRAM 142 209 1.21e-26 SMART
GRAM 288 356 3.02e-22 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 422 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
TBC 506 719 1.18e-57 SMART
Blast:TBC 727 810 3e-28 BLAST
low complexity region 970 980 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
low complexity region 1161 1172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Tbc1d9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tbc1d9b APN 11 50161633 missense probably damaging 1.00
IGL01870:Tbc1d9b APN 11 50162088 missense probably damaging 1.00
IGL02082:Tbc1d9b APN 11 50163882 missense probably benign 0.00
IGL02105:Tbc1d9b APN 11 50149826 missense probably damaging 0.96
IGL02264:Tbc1d9b APN 11 50149757 missense probably damaging 0.98
IGL02801:Tbc1d9b APN 11 50152830 missense probably damaging 1.00
IGL03111:Tbc1d9b APN 11 50158542 missense probably damaging 1.00
IGL02988:Tbc1d9b UTSW 11 50151946 missense possibly damaging 0.80
R0102:Tbc1d9b UTSW 11 50135849 missense probably damaging 1.00
R0109:Tbc1d9b UTSW 11 50158434 missense probably benign 0.02
R0131:Tbc1d9b UTSW 11 50135924 missense probably benign
R0463:Tbc1d9b UTSW 11 50145067 missense probably benign 0.00
R0472:Tbc1d9b UTSW 11 50168228 splice site probably null
R0846:Tbc1d9b UTSW 11 50171321 missense probably benign 0.01
R1099:Tbc1d9b UTSW 11 50146308 missense probably benign 0.04
R1276:Tbc1d9b UTSW 11 50152649 missense possibly damaging 0.87
R1642:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
R2679:Tbc1d9b UTSW 11 50161701 splice site probably null
R2915:Tbc1d9b UTSW 11 50149736 missense possibly damaging 0.95
R3825:Tbc1d9b UTSW 11 50171127 missense possibly damaging 0.85
R3964:Tbc1d9b UTSW 11 50168696 missense possibly damaging 0.50
R4051:Tbc1d9b UTSW 11 50171243 missense probably benign 0.09
R4705:Tbc1d9b UTSW 11 50140462 missense probably benign 0.33
R4783:Tbc1d9b UTSW 11 50171298 missense probably benign 0.00
R5330:Tbc1d9b UTSW 11 50146313 missense probably benign
R5331:Tbc1d9b UTSW 11 50146313 missense probably benign
R5888:Tbc1d9b UTSW 11 50140484 missense probably benign 0.15
R5949:Tbc1d9b UTSW 11 50148049 missense probably benign
R6144:Tbc1d9b UTSW 11 50146328 missense probably benign
R6166:Tbc1d9b UTSW 11 50135846 missense probably damaging 1.00
R6331:Tbc1d9b UTSW 11 50131497 missense possibly damaging 0.95
R6432:Tbc1d9b UTSW 11 50146328 missense probably benign
R6856:Tbc1d9b UTSW 11 50168746 missense probably benign 0.11
R7110:Tbc1d9b UTSW 11 50163830 missense probably benign 0.09
R7134:Tbc1d9b UTSW 11 50152692 missense possibly damaging 0.55
R7372:Tbc1d9b UTSW 11 50168688 splice site probably null
R7464:Tbc1d9b UTSW 11 50131485 missense probably damaging 1.00
R7584:Tbc1d9b UTSW 11 50170716 missense probably damaging 1.00
R7730:Tbc1d9b UTSW 11 50135915 missense possibly damaging 0.89
R7747:Tbc1d9b UTSW 11 50161620 missense probably benign 0.39
R8260:Tbc1d9b UTSW 11 50164186 missense probably benign 0.26
R8345:Tbc1d9b UTSW 11 50149832 missense probably damaging 0.98
X0065:Tbc1d9b UTSW 11 50168183 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCCTAGATTCTGGGTTCCTG -3'
(R):5'- GCTTTGGATCAGCAATGAGGTC -3'

Sequencing Primer
(F):5'- AGATTCTGGGTTCCTGGCCTC -3'
(R):5'- TCAGCAATGAGGTCAGGGAGTC -3'
Posted On2019-10-17