Incidental Mutation 'R7508:Odf4'
ID581905
Institutional Source Beutler Lab
Gene Symbol Odf4
Ensembl Gene ENSMUSG00000032921
Gene Nameouter dense fiber of sperm tails 4
SynonymsOppo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68921835-68927081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68922423 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 218 (C218S)
Ref Sequence ENSEMBL: ENSMUSP00000040050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038932] [ENSMUST00000125134] [ENSMUST00000130271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038932
AA Change: C218S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040050
Gene: ENSMUSG00000032921
AA Change: C218S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 42 222 1.1e-8 PFAM
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125134
SMART Domains Protein: ENSMUSP00000133636
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130271
SMART Domains Protein: ENSMUSP00000134383
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156828
SMART Domains Protein: ENSMUSP00000133569
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Odf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Odf4 APN 11 68921952 unclassified probably benign
IGL01782:Odf4 APN 11 68926633 missense probably damaging 0.98
BB006:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
BB016:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R1945:Odf4 UTSW 11 68922157 missense possibly damaging 0.53
R4551:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4552:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4685:Odf4 UTSW 11 68922839 critical splice donor site probably null
R4707:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R5163:Odf4 UTSW 11 68922846 missense probably damaging 1.00
R6657:Odf4 UTSW 11 68926812 missense probably benign 0.12
R7073:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R7778:Odf4 UTSW 11 68922072 missense probably benign 0.01
R7824:Odf4 UTSW 11 68922072 missense probably benign 0.01
R7929:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
X0025:Odf4 UTSW 11 68926790 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAAAGAATCCCTGGCAGG -3'
(R):5'- CCCTGTGCAATTCTTAGGTGAG -3'

Sequencing Primer
(F):5'- TCTGAAAGTGGCATGGAAGGTG -3'
(R):5'- GTGAGAATAAGATCTCTCCACTCCTG -3'
Posted On2019-10-17