Incidental Mutation 'R7508:Egln3'
ID581907
Institutional Source Beutler Lab
Gene Symbol Egln3
Ensembl Gene ENSMUSG00000035105
Gene Nameegl-9 family hypoxia-inducible factor 3
SynonymsHif-p4h-3, 2610021G09Rik, Phd3, SM-20
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location54178981-54203860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54180628 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 239 (D239G)
Ref Sequence ENSEMBL: ENSMUSP00000041874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039516]
Predicted Effect probably benign
Transcript: ENSMUST00000039516
AA Change: D239G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041874
Gene: ENSMUSG00000035105
AA Change: D239G

DomainStartEndE-ValueType
P4Hc 26 213 9.48e-47 SMART
Meta Mutation Damage Score 0.1165 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mice display decreased apoptosis in SCG neurons, reduced adrenal medullary secretory capacity, abnormal adrenal medulla morphology, reduced circulating adrenaline and noradrenaline levels, and reduced systolic blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Egln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02675:Egln3 APN 12 54203210 missense probably benign 0.08
IGL03104:Egln3 APN 12 54203195 splice site probably benign
R0036:Egln3 UTSW 12 54185592 missense possibly damaging 0.95
R0091:Egln3 UTSW 12 54181646 missense probably benign 0.07
R0325:Egln3 UTSW 12 54203512 missense probably benign 0.09
R0358:Egln3 UTSW 12 54203296 missense possibly damaging 0.68
R0494:Egln3 UTSW 12 54203321 missense probably benign 0.01
R1241:Egln3 UTSW 12 54181693 missense probably damaging 1.00
R4786:Egln3 UTSW 12 54185581 missense probably damaging 0.99
R5078:Egln3 UTSW 12 54181667 missense probably damaging 1.00
R5496:Egln3 UTSW 12 54203324 missense probably damaging 1.00
R5692:Egln3 UTSW 12 54180661 splice site probably null
R6038:Egln3 UTSW 12 54181690 missense probably damaging 0.98
R6038:Egln3 UTSW 12 54181690 missense probably damaging 0.98
R6732:Egln3 UTSW 12 54180641 missense probably benign
R6944:Egln3 UTSW 12 54183952 missense probably benign 0.00
R8204:Egln3 UTSW 12 54203224 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGGATGTCGTCTGCAGGTATTTC -3'
(R):5'- CCAAGACAGACAGACAGCTTTG -3'

Sequencing Primer
(F):5'- TTCATCTGGCAAAGAGAGTGTC -3'
(R):5'- CAGACAGACAGCTTTGCAAAG -3'
Posted On2019-10-17