Incidental Mutation 'R7508:Zfp369'
ID581915
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Namezinc finger protein 369
SynonymsB930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65278814-65304221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65279273 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 10 (F10S)
Ref Sequence ENSEMBL: ENSMUSP00000119114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799] [ENSMUST00000155732]
Predicted Effect unknown
Transcript: ENSMUST00000126879
AA Change: F10S
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514
AA Change: F10S

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130799
AA Change: F10S
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514
AA Change: F10S

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155732
SMART Domains Protein: ENSMUSP00000119796
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 14 70 1.36e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65297260 missense probably benign 0.41
IGL01393:Zfp369 APN 13 65294474 missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65284932 missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65280281 missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65294451 missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65294410 missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65296153 missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65297202 missense probably benign 0.08
R0600:Zfp369 UTSW 13 65296434 missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65297548 missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65292293 missense probably damaging 0.99
R1191:Zfp369 UTSW 13 65291962 nonsense probably null
R1528:Zfp369 UTSW 13 65292165 missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65297151 missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65296948 missense probably benign 0.01
R4386:Zfp369 UTSW 13 65296992 missense probably benign 0.00
R4928:Zfp369 UTSW 13 65296800 missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65279033 start gained probably benign
R5549:Zfp369 UTSW 13 65297380 missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65296767 missense probably benign
R5743:Zfp369 UTSW 13 65295680 missense probably benign 0.02
R5840:Zfp369 UTSW 13 65297278 missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65296230 missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65296117 missense probably damaging 0.98
R7288:Zfp369 UTSW 13 65285018 critical splice donor site probably null
R7314:Zfp369 UTSW 13 65292104 missense probably damaging 0.97
R7470:Zfp369 UTSW 13 65292146 missense probably benign 0.12
R7796:Zfp369 UTSW 13 65296215 missense probably benign
R7886:Zfp369 UTSW 13 65292054 missense possibly damaging 0.95
R8425:Zfp369 UTSW 13 65296675 missense possibly damaging 0.96
Z1177:Zfp369 UTSW 13 65292160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAAGAAAACCGACCGCATTC -3'
(R):5'- CTTGGGCAGTCCTTCAACTC -3'

Sequencing Primer
(F):5'- CATTCTGGATTGGAGGACATCAACC -3'
(R):5'- CCTCCCGTAACTCTAGGGTATTTGAG -3'
Posted On2019-10-17