Incidental Mutation 'R7508:Adra1a'
ID581919
Institutional Source Beutler Lab
Gene Symbol Adra1a
Ensembl Gene ENSMUSG00000045875
Gene Nameadrenergic receptor, alpha 1a
SynonymsAdra1c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66635251-66771168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 66637935 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 120 (I120L)
Ref Sequence ENSEMBL: ENSMUSP00000053703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054661] [ENSMUST00000159068] [ENSMUST00000159365] [ENSMUST00000161339] [ENSMUST00000225182]
Predicted Effect probably damaging
Transcript: ENSMUST00000054661
AA Change: I120L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053703
Gene: ENSMUSG00000045875
AA Change: I120L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 1.7e-80 PFAM
Pfam:7TM_GPCR_Srv 44 343 4.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159068
AA Change: I120L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124570
Gene: ENSMUSG00000045875
AA Change: I120L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159365
AA Change: I120L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124322
Gene: ENSMUSG00000045875
AA Change: I120L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 1.7e-17 PFAM
Pfam:7tm_1 43 326 1.8e-83 PFAM
Pfam:7TM_GPCR_Srv 44 343 7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161339
AA Change: I120L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125354
Gene: ENSMUSG00000045875
AA Change: I120L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225182
AA Change: I120L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes one of several multipass transmembrane proteins that function as G protein-coupled receptors. The encoded protein binds to epinephrine and norepinephrine to mediate signaling in cells of the cardiac, nervous, and other organ systems. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mutations in this gene result in hypotension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Adra1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Adra1a APN 14 66637873 missense probably damaging 1.00
IGL02751:Adra1a APN 14 66727532 missense possibly damaging 0.76
IGL02755:Adra1a APN 14 66727661 missense probably benign
IGL03367:Adra1a APN 14 66637989 missense possibly damaging 0.89
R0610:Adra1a UTSW 14 66637792 missense probably damaging 1.00
R0840:Adra1a UTSW 14 66727710 missense possibly damaging 0.73
R1720:Adra1a UTSW 14 66638278 missense probably damaging 1.00
R1902:Adra1a UTSW 14 66638235 missense probably benign 0.30
R2131:Adra1a UTSW 14 66727532 missense possibly damaging 0.76
R2198:Adra1a UTSW 14 66637936 missense probably damaging 1.00
R4702:Adra1a UTSW 14 66637559 start gained probably benign
R4761:Adra1a UTSW 14 66727431 splice site probably null
R4784:Adra1a UTSW 14 66637824 missense probably damaging 1.00
R4814:Adra1a UTSW 14 66638032 missense probably benign 0.01
R5844:Adra1a UTSW 14 66727734 missense probably benign 0.02
R7346:Adra1a UTSW 14 66638284 missense probably benign 0.16
R7689:Adra1a UTSW 14 66637801 missense probably damaging 1.00
Z1088:Adra1a UTSW 14 66727496 missense probably damaging 0.98
Z1176:Adra1a UTSW 14 66727628 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CATTGTCAACCTGGCTGTGG -3'
(R):5'- ATGATGGTCAGTGGCACGTAG -3'

Sequencing Primer
(F):5'- TGTGGCAGACCTCCTCC -3'
(R):5'- CTGAGAACAGCACGTATCCTGG -3'
Posted On2019-10-17