Incidental Mutation 'R7508:Gpd1'
ID581921
Institutional Source Beutler Lab
Gene Symbol Gpd1
Ensembl Gene ENSMUSG00000023019
Gene Nameglycerol-3-phosphate dehydrogenase 1 (soluble)
SynonymsGdc1, Gdc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99717515-99725005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99722086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 255 (S255N)
Ref Sequence ENSEMBL: ENSMUSP00000023760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023760] [ENSMUST00000023761] [ENSMUST00000162194]
Predicted Effect probably damaging
Transcript: ENSMUST00000023760
AA Change: S255N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023760
Gene: ENSMUSG00000023019
AA Change: S255N

DomainStartEndE-ValueType
Pfam:NAD_Gly3P_dh_N 5 174 6.2e-57 PFAM
Pfam:NAD_Gly3P_dh_C 193 340 8.5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023761
SMART Domains Protein: ENSMUSP00000023761
Gene: ENSMUSG00000023020

DomainStartEndE-ValueType
Pfam:COX14 1 55 1.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162194
AA Change: S232N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125164
Gene: ENSMUSG00000023019
AA Change: S232N

DomainStartEndE-ValueType
Pfam:NAD_Gly3P_dh_N 5 77 3.6e-21 PFAM
Pfam:NAD_Gly3P_dh_N 71 151 1.9e-22 PFAM
Pfam:NAD_Gly3P_dh_C 169 319 4.2e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. The encoded protein plays a critical role in carbohydrate and lipid metabolism by catalyzing the reversible conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. The encoded cytosolic protein and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in this gene are a cause of transient infantile hypertriglyceridemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation are viable and phenotypically normal but show loss of glycerol-3-phosphate dehydrogenase 1 activity in adult tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Gpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Gpd1 APN 15 99720651 missense probably benign 0.01
IGL01338:Gpd1 APN 15 99718175 missense probably damaging 0.98
IGL01947:Gpd1 APN 15 99720231 missense possibly damaging 0.64
R0366:Gpd1 UTSW 15 99719270 missense probably damaging 1.00
R0551:Gpd1 UTSW 15 99720629 missense possibly damaging 0.95
R1789:Gpd1 UTSW 15 99723202 missense probably damaging 1.00
R2429:Gpd1 UTSW 15 99720607 missense probably benign 0.01
R4130:Gpd1 UTSW 15 99719277 splice site probably null
R5218:Gpd1 UTSW 15 99720130 missense probably damaging 1.00
R5348:Gpd1 UTSW 15 99722140 missense possibly damaging 0.60
R5636:Gpd1 UTSW 15 99722058 missense probably benign
R6228:Gpd1 UTSW 15 99723265 missense possibly damaging 0.80
R7196:Gpd1 UTSW 15 99722055 missense probably benign 0.10
R7479:Gpd1 UTSW 15 99720103 missense probably benign 0.04
R7509:Gpd1 UTSW 15 99722086 missense probably damaging 1.00
R7714:Gpd1 UTSW 15 99722086 missense probably damaging 1.00
R7716:Gpd1 UTSW 15 99722086 missense probably damaging 1.00
R8044:Gpd1 UTSW 15 99723202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATACATGCAGCATGGG -3'
(R):5'- TCACTGTCCATCTGAGACAGGG -3'

Sequencing Primer
(F):5'- CTGGAGAGGCAAATTTCTCACCTG -3'
(R):5'- TCCATCTGAGACAGGGTCTGG -3'
Posted On2019-10-17