Incidental Mutation 'R7508:Neurl1b'
ID581922
Institutional Source Beutler Lab
Gene Symbol Neurl1b
Ensembl Gene ENSMUSG00000034413
Gene Nameneuralized E3 ubiquitin protein ligase 1B
SynonymsC230078M08Rik, Neur2, EG240055
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7508 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26414829-26446349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 26438746 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 219 (H219Q)
Ref Sequence ENSEMBL: ENSMUSP00000051481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053020] [ENSMUST00000182897] [ENSMUST00000183077]
Predicted Effect probably benign
Transcript: ENSMUST00000053020
AA Change: H219Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051481
Gene: ENSMUSG00000034413
AA Change: H219Q

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 192 1e-12 BLAST
Blast:NEUZ 219 245 1e-8 BLAST
NEUZ 268 390 7.66e-24 SMART
low complexity region 436 449 N/A INTRINSIC
low complexity region 457 486 N/A INTRINSIC
RING 494 533 2.38e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182897
AA Change: H37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138417
Gene: ENSMUSG00000034413
AA Change: H37Q

DomainStartEndE-ValueType
Blast:NEUZ 37 63 5e-9 BLAST
Pfam:Neuralized 88 156 2.8e-14 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 304 N/A INTRINSIC
RING 312 351 2.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183077
SMART Domains Protein: ENSMUSP00000138178
Gene: ENSMUSG00000034413

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 225 2e-14 BLAST
low complexity region 226 255 N/A INTRINSIC
RING 263 302 2.38e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,016,867 A110T probably benign Het
Adra1a A C 14: 66,637,935 I120L probably damaging Het
Ahnak2 C T 12: 112,774,405 V1078I possibly damaging Het
Ccser1 A G 6: 61,570,723 H590R probably benign Het
Cdh12 T G 15: 21,583,765 L564V probably benign Het
Celsr3 T A 9: 108,836,622 H1900Q probably benign Het
Clasp1 T A 1: 118,545,434 M918K probably benign Het
Cmtm6 A G 9: 114,731,240 E2G probably damaging Het
Ctsg A G 14: 56,100,541 probably null Het
Cylc2 T A 4: 51,229,256 probably null Het
Dna2 A G 10: 62,971,993 probably null Het
Dnaic1 G A 4: 41,614,323 R333H probably benign Het
Egln3 T C 12: 54,180,628 D239G probably benign Het
Fam13a A T 6: 58,987,284 D54E probably damaging Het
Fn1 A G 1: 71,597,516 V2159A probably benign Het
Gcnt2 T A 13: 40,887,681 F105L probably benign Het
Gm5788 T C 12: 87,494,842 M41T possibly damaging Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Hacd4 A G 4: 88,437,478 F57L probably benign Het
Helb T C 10: 120,105,283 D500G probably benign Het
Ighv1-26 G A 12: 114,788,442 S94F probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Klra7 A T 6: 130,230,091 probably null Het
Lyl1 T C 8: 84,704,300 V277A probably benign Het
Mon2 A C 10: 123,023,939 W811G probably damaging Het
Myo9b T C 8: 71,354,801 L1627P probably benign Het
Odf4 A T 11: 68,922,423 C218S possibly damaging Het
Olfr1038-ps A G 2: 86,121,938 N5S possibly damaging Het
Olfr11 T A 13: 21,638,609 I305F probably benign Het
Pde5a A G 3: 122,818,030 D571G probably damaging Het
Pgc A G 17: 47,734,186 E343G probably benign Het
Pik3cd A G 4: 149,654,583 F667L possibly damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Ptprb C T 10: 116,353,991 Q1565* probably null Het
Rapgef4 T A 2: 72,205,733 N523K probably benign Het
Rbm25 T C 12: 83,672,877 L557P probably damaging Het
Rhobtb3 C T 13: 75,878,857 V466I probably benign Het
Rnpep A G 1: 135,278,858 V166A probably benign Het
Sgo2a A G 1: 58,017,795 K1046R probably benign Het
Slc12a2 T C 18: 57,904,393 V525A probably benign Het
Slc1a4 A T 11: 20,306,487 I448N probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Slc9a5 T A 8: 105,363,253 probably null Het
Spag16 A T 1: 69,887,520 N258I possibly damaging Het
Sspo T A 6: 48,466,699 L2076Q probably damaging Het
Taok1 T A 11: 77,545,326 H704L probably damaging Het
Tbc1d9b T C 11: 50,145,120 F148L probably damaging Het
Tm4sf1 A G 3: 57,294,755 Y12H probably benign Het
Traj6 C T 14: 54,212,714 T9M Het
Ttll4 A G 1: 74,687,259 N672S possibly damaging Het
Ube3a T A 7: 59,303,689 H790Q possibly damaging Het
Usp49 G A 17: 47,672,280 R70Q probably benign Het
Vmn2r32 C T 7: 7,467,374 V515M possibly damaging Het
Wars A G 12: 108,882,875 S49P probably benign Het
Zbp1 T A 2: 173,207,811 Q386L possibly damaging Het
Zfp369 T C 13: 65,279,273 F10S unknown Het
Zfp512 C G 5: 31,473,539 I408M possibly damaging Het
Zfp952 A G 17: 33,003,782 I412V probably benign Het
Other mutations in Neurl1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Neurl1b APN 17 26432178 missense probably damaging 0.99
R0530:Neurl1b UTSW 17 26441545 splice site probably null
R1819:Neurl1b UTSW 17 26438700 missense probably benign 0.01
R2359:Neurl1b UTSW 17 26441595 missense probably benign 0.03
R3720:Neurl1b UTSW 17 26414975 missense probably damaging 1.00
R4574:Neurl1b UTSW 17 26431886 missense probably benign 0.19
R7509:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7642:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7654:Neurl1b UTSW 17 26438697 missense probably benign 0.00
R7669:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7670:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7722:Neurl1b UTSW 17 26441158 missense probably benign
R8069:Neurl1b UTSW 17 26432227 missense probably damaging 1.00
R8343:Neurl1b UTSW 17 26431991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGGTTGCAGGTCAGG -3'
(R):5'- AGTATTCCTTGCGGTCCAGC -3'

Sequencing Primer
(F):5'- TTGCAGGTCAGGGGCAACTG -3'
(R):5'- ATCGCAGGACGTGATGC -3'
Posted On2019-10-17