Incidental Mutation 'R7509:Erbb4'
ID581929
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7509 (G1)
Quality Score172.009
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68250580 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 767 (D767E)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: D767E

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: D767E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121473
AA Change: D767E

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: D767E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A G 7: 119,534,388 S259G probably benign Het
Adamts16 G T 13: 70,787,164 N436K probably damaging Het
Asb3 T A 11: 30,998,507 M61K probably benign Het
Catspere2 A G 1: 178,077,512 T163A possibly damaging Het
Ccser2 A G 14: 36,938,645 L517P probably damaging Het
Cd226 A G 18: 89,247,071 T158A probably benign Het
Chd6 A T 2: 161,013,154 I778N probably damaging Het
Cnga4 T C 7: 105,406,890 V336A probably benign Het
Cpd C T 11: 76,797,876 V857I probably benign Het
Cpm A G 10: 117,659,840 Y78C probably damaging Het
Cst7 A T 2: 150,577,704 T97S probably benign Het
Cttnbp2nl T C 3: 105,032,730 K8E possibly damaging Het
Esyt2 T C 12: 116,365,876 S685P probably damaging Het
Gcfc2 T C 6: 81,953,275 L641P probably damaging Het
Gcnt4 T A 13: 96,947,170 F325I probably benign Het
Glg1 T G 8: 111,259,043 S52R probably benign Het
Gm10577 G A 4: 101,020,651 L16F unknown Het
Gm14326 C T 2: 177,945,700 G501D probably benign Het
Gm1587 G A 14: 77,797,024 P35S unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grrp1 A C 4: 134,252,113 V18G probably damaging Het
Helb T A 10: 120,089,814 H886L probably damaging Het
Hgsnat A G 8: 25,955,726 V380A probably damaging Het
Hmbs T A 9: 44,336,911 R125S Het
Hsd17b4 A T 18: 50,164,682 Y346F probably damaging Het
Inpp4a T C 1: 37,387,830 L624P probably damaging Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Itga11 C T 9: 62,781,940 T1129I probably benign Het
Itih4 G A 14: 30,895,447 V575I probably benign Het
Kcnn2 A G 18: 45,683,120 T473A probably benign Het
Kidins220 T C 12: 24,982,361 V31A probably damaging Het
Lrch1 G A 14: 74,947,608 T18I probably benign Het
Ly6e T C 15: 74,958,286 F30L probably damaging Het
Med13l A G 5: 118,748,930 D1632G probably damaging Het
Mei4 T A 9: 82,025,577 L320Q probably damaging Het
Mlip T G 9: 77,181,396 T197P probably damaging Het
Mon2 G A 10: 123,032,552 A532V probably benign Het
Myh1 C T 11: 67,210,461 P688S probably benign Het
Ncapg G A 5: 45,696,108 D900N probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Ntn4 A G 10: 93,710,568 N361S probably benign Het
Nudt16l1 T A 16: 4,939,218 H26Q probably damaging Het
Obscn G A 11: 59,051,629 T4348I probably benign Het
Olfr898 T A 9: 38,349,572 M157K probably benign Het
Olfr960 T A 9: 39,623,327 I66N probably damaging Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pcdhb7 C A 18: 37,342,021 T70K possibly damaging Het
Pcdhga3 T A 18: 37,675,857 Y454* probably null Het
Pigc A T 1: 161,970,976 T176S probably benign Het
Pola2 A T 19: 5,961,166 S43R probably benign Het
Pole A T 5: 110,330,705 probably benign Het
Polq C A 16: 37,060,343 D956E probably benign Het
Polq T A 16: 37,060,344 C957S probably benign Het
Ppp3cc G A 14: 70,266,682 T107I probably damaging Het
Prss39 C A 1: 34,500,199 H173Q possibly damaging Het
Reep4 A G 14: 70,548,488 D256G probably benign Het
Rfc3 A G 5: 151,647,510 V107A probably damaging Het
Slc19a3 A G 1: 83,026,260 L40P probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Strada C A 11: 106,187,094 V15F unknown Het
Suco A T 1: 161,845,334 S440T probably damaging Het
Svep1 A T 4: 58,090,683 C1595S probably benign Het
Synpo G T 18: 60,603,494 T460K probably damaging Het
Tagap A T 17: 7,928,736 I93F probably damaging Het
Tmtc3 A T 10: 100,466,094 F331Y probably damaging Het
Tnpo1 A C 13: 98,870,243 I225M probably benign Het
Tollip A T 7: 141,892,141 M70K probably benign Het
Trpm7 A T 2: 126,849,922 I171N probably damaging Het
Ttc41 G T 10: 86,713,432 E163D probably damaging Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Vmn2r20 C T 6: 123,385,423 V801I probably benign Het
Vmn2r82 G A 10: 79,396,008 V614I possibly damaging Het
Vmn2r96 G A 17: 18,582,733 E302K probably benign Het
Vwf T C 6: 125,642,169 F1270S Het
Wdr3 A T 3: 100,151,187 F367L probably benign Het
Zfp592 A G 7: 81,038,340 S1005G probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATCAGGGATGTTCTGAAAGGTAC -3'
(R):5'- CGATAATCCATGCATTCTTATCTAGCC -3'

Sequencing Primer
(F):5'- TTCTGAAAGGTACAGGGTATAGTG -3'
(R):5'- TTAAAATGGAGGCCATGAACTTG -3'
Posted On2019-10-17