Incidental Mutation 'R7509:Erbb4'
ID 581929
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 045582-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7509 (G1)
Quality Score 172.009
Status Validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68289739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 767 (D767E)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: D767E

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: D767E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121473
AA Change: D767E

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: D767E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A G 7: 119,133,611 (GRCm39) S259G probably benign Het
Adamts16 G T 13: 70,935,283 (GRCm39) N436K probably damaging Het
Asb3 T A 11: 30,948,507 (GRCm39) M61K probably benign Het
Catspere2 A G 1: 177,905,078 (GRCm39) T163A possibly damaging Het
Ccser2 A G 14: 36,660,602 (GRCm39) L517P probably damaging Het
Cd226 A G 18: 89,265,195 (GRCm39) T158A probably benign Het
Chd6 A T 2: 160,855,074 (GRCm39) I778N probably damaging Het
Cnga4 T C 7: 105,056,097 (GRCm39) V336A probably benign Het
Cpd C T 11: 76,688,702 (GRCm39) V857I probably benign Het
Cpm A G 10: 117,495,745 (GRCm39) Y78C probably damaging Het
Cst7 A T 2: 150,419,624 (GRCm39) T97S probably benign Het
Cttnbp2nl T C 3: 104,940,046 (GRCm39) K8E possibly damaging Het
Esyt2 T C 12: 116,329,496 (GRCm39) S685P probably damaging Het
Fam110d A C 4: 133,979,424 (GRCm39) V18G probably damaging Het
Gcfc2 T C 6: 81,930,256 (GRCm39) L641P probably damaging Het
Gcnt4 T A 13: 97,083,678 (GRCm39) F325I probably benign Het
Glg1 T G 8: 111,985,675 (GRCm39) S52R probably benign Het
Gm10577 G A 4: 100,877,848 (GRCm39) L16F unknown Het
Gm14326 C T 2: 177,587,493 (GRCm39) G501D probably benign Het
Gm1587 G A 14: 78,034,464 (GRCm39) P35S unknown Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Helb T A 10: 119,925,719 (GRCm39) H886L probably damaging Het
Hgsnat A G 8: 26,445,754 (GRCm39) V380A probably damaging Het
Hmbs T A 9: 44,248,208 (GRCm39) R125S Het
Hsd17b4 A T 18: 50,297,749 (GRCm39) Y346F probably damaging Het
Inpp4a T C 1: 37,426,911 (GRCm39) L624P probably damaging Het
Irak2 AC ACC 6: 113,667,859 (GRCm39) probably null Het
Itga11 C T 9: 62,689,222 (GRCm39) T1129I probably benign Het
Itih4 G A 14: 30,617,404 (GRCm39) V575I probably benign Het
Kcnn2 A G 18: 45,816,187 (GRCm39) T473A probably benign Het
Kidins220 T C 12: 25,032,360 (GRCm39) V31A probably damaging Het
Lrch1 G A 14: 75,185,048 (GRCm39) T18I probably benign Het
Ly6e T C 15: 74,830,135 (GRCm39) F30L probably damaging Het
Med13l A G 5: 118,886,995 (GRCm39) D1632G probably damaging Het
Mei4 T A 9: 81,907,630 (GRCm39) L320Q probably damaging Het
Mlip T G 9: 77,088,678 (GRCm39) T197P probably damaging Het
Mon2 G A 10: 122,868,457 (GRCm39) A532V probably benign Het
Myh1 C T 11: 67,101,287 (GRCm39) P688S probably benign Het
Ncapg G A 5: 45,853,450 (GRCm39) D900N probably benign Het
Neurl1b C G 17: 26,657,720 (GRCm39) H219Q probably benign Het
Ntn4 A G 10: 93,546,430 (GRCm39) N361S probably benign Het
Nudt16l1 T A 16: 4,757,082 (GRCm39) H26Q probably damaging Het
Obscn G A 11: 58,942,455 (GRCm39) T4348I probably benign Het
Or10d4b T A 9: 39,534,623 (GRCm39) I66N probably damaging Het
Or8c20 T A 9: 38,260,868 (GRCm39) M157K probably benign Het
Pcdh7 T A 5: 57,877,529 (GRCm39) D361E probably damaging Het
Pcdhb7 C A 18: 37,475,074 (GRCm39) T70K possibly damaging Het
Pcdhga3 T A 18: 37,808,910 (GRCm39) Y454* probably null Het
Pigc A T 1: 161,798,545 (GRCm39) T176S probably benign Het
Pola2 A T 19: 6,011,194 (GRCm39) S43R probably benign Het
Pole A T 5: 110,478,571 (GRCm39) probably benign Het
Polq C A 16: 36,880,705 (GRCm39) D956E probably benign Het
Polq T A 16: 36,880,706 (GRCm39) C957S probably benign Het
Ppp3cc G A 14: 70,504,131 (GRCm39) T107I probably damaging Het
Prss39 C A 1: 34,539,280 (GRCm39) H173Q possibly damaging Het
Reep4 A G 14: 70,785,928 (GRCm39) D256G probably benign Het
Rfc3 A G 5: 151,570,975 (GRCm39) V107A probably damaging Het
Slc19a3 A G 1: 83,003,981 (GRCm39) L40P probably damaging Het
Slc29a4 C T 5: 142,704,261 (GRCm39) P305L probably benign Het
Strada C A 11: 106,077,920 (GRCm39) V15F unknown Het
Suco A T 1: 161,672,903 (GRCm39) S440T probably damaging Het
Svep1 A T 4: 58,090,683 (GRCm39) C1595S probably benign Het
Synpo G T 18: 60,736,566 (GRCm39) T460K probably damaging Het
Tagap A T 17: 8,147,568 (GRCm39) I93F probably damaging Het
Tmtc3 A T 10: 100,301,956 (GRCm39) F331Y probably damaging Het
Tnpo1 A C 13: 99,006,751 (GRCm39) I225M probably benign Het
Tollip A T 7: 141,445,878 (GRCm39) M70K probably benign Het
Trpm7 A T 2: 126,691,842 (GRCm39) I171N probably damaging Het
Ttc41 G T 10: 86,549,296 (GRCm39) E163D probably damaging Het
Vmn2r17 A T 5: 109,575,695 (GRCm39) T189S probably benign Het
Vmn2r20 C T 6: 123,362,382 (GRCm39) V801I probably benign Het
Vmn2r82 G A 10: 79,231,842 (GRCm39) V614I possibly damaging Het
Vmn2r96 G A 17: 18,802,995 (GRCm39) E302K probably benign Het
Vwf T C 6: 125,619,132 (GRCm39) F1270S Het
Wdr3 A T 3: 100,058,503 (GRCm39) F367L probably benign Het
Zfp592 A G 7: 80,688,088 (GRCm39) S1005G probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATCAGGGATGTTCTGAAAGGTAC -3'
(R):5'- CGATAATCCATGCATTCTTATCTAGCC -3'

Sequencing Primer
(F):5'- TTCTGAAAGGTACAGGGTATAGTG -3'
(R):5'- TTAAAATGGAGGCCATGAACTTG -3'
Posted On 2019-10-17