Mutagenetix > Incidental Mutations

Incidental Mutation 'R7509:Chd6'

581936

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

6330406J24Rik, 5430439G14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.804) question?

Stock #

R7509 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160946978-161109075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 161013154 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 778 (I778N)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039782
AA Change: I778N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: I778N

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: I777N

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	213	228	N/A	INTRINSIC
CHROMO	288	354	1.35e-4	SMART
CHROMO	371	429	3.48e-7	SMART
DEXDc	455	657	1.73e-39	SMART
HELICc	811	895	3.84e-23	SMART
low complexity region	1079	1093	N/A	INTRINSIC
Blast:DEXDc	1107	1152	4e-23	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	A	G	7: 119,534,388	S259G	probably benign	Het
Adamts16	G	T	13: 70,787,164	N436K	probably damaging	Het
Asb3	T	A	11: 30,998,507	M61K	probably benign	Het
Catspere2	A	G	1: 178,077,512	T163A	possibly damaging	Het
Ccser2	A	G	14: 36,938,645	L517P	probably damaging	Het
Cd226	A	G	18: 89,247,071	T158A	probably benign	Het
Cnga4	T	C	7: 105,406,890	V336A	probably benign	Het
Cpd	C	T	11: 76,797,876	V857I	probably benign	Het
Cpm	A	G	10: 117,659,840	Y78C	probably damaging	Het
Cst7	A	T	2: 150,577,704	T97S	probably benign	Het
Cttnbp2nl	T	C	3: 105,032,730	K8E	possibly damaging	Het
Erbb4	A	T	1: 68,250,580	D767E	possibly damaging	Het
Esyt2	T	C	12: 116,365,876	S685P	probably damaging	Het
Gcfc2	T	C	6: 81,953,275	L641P	probably damaging	Het
Gcnt4	T	A	13: 96,947,170	F325I	probably benign	Het
Glg1	T	G	8: 111,259,043	S52R	probably benign	Het
Gm10577	G	A	4: 101,020,651	L16F	unknown	Het
Gm14326	C	T	2: 177,945,700	G501D	probably benign	Het
Gm1587	G	A	14: 77,797,024	P35S	unknown	Het
Gpd1	G	A	15: 99,722,086	S255N	probably damaging	Het
Grrp1	A	C	4: 134,252,113	V18G	probably damaging	Het
Helb	T	A	10: 120,089,814	H886L	probably damaging	Het
Hgsnat	A	G	8: 25,955,726	V380A	probably damaging	Het
Hmbs	T	A	9: 44,336,911	R125S		Het
Hsd17b4	A	T	18: 50,164,682	Y346F	probably damaging	Het
Inpp4a	T	C	1: 37,387,830	L624P	probably damaging	Het
Irak2	AC	ACC	6: 113,690,898		probably null	Het
Itga11	C	T	9: 62,781,940	T1129I	probably benign	Het
Itih4	G	A	14: 30,895,447	V575I	probably benign	Het
Kcnn2	A	G	18: 45,683,120	T473A	probably benign	Het
Kidins220	T	C	12: 24,982,361	V31A	probably damaging	Het
Lrch1	G	A	14: 74,947,608	T18I	probably benign	Het
Ly6e	T	C	15: 74,958,286	F30L	probably damaging	Het
Med13l	A	G	5: 118,748,930	D1632G	probably damaging	Het
Mei4	T	A	9: 82,025,577	L320Q	probably damaging	Het
Mlip	T	G	9: 77,181,396	T197P	probably damaging	Het
Mon2	G	A	10: 123,032,552	A532V	probably benign	Het
Myh1	C	T	11: 67,210,461	P688S	probably benign	Het
Ncapg	G	A	5: 45,696,108	D900N	probably benign	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Ntn4	A	G	10: 93,710,568	N361S	probably benign	Het
Nudt16l1	T	A	16: 4,939,218	H26Q	probably damaging	Het
Obscn	G	A	11: 59,051,629	T4348I	probably benign	Het
Olfr898	T	A	9: 38,349,572	M157K	probably benign	Het
Olfr960	T	A	9: 39,623,327	I66N	probably damaging	Het
Pcdh7	T	A	5: 57,720,187	D361E	probably damaging	Het
Pcdhb7	C	A	18: 37,342,021	T70K	possibly damaging	Het
Pcdhga3	T	A	18: 37,675,857	Y454*	probably null	Het
Pigc	A	T	1: 161,970,976	T176S	probably benign	Het
Pola2	A	T	19: 5,961,166	S43R	probably benign	Het
Pole	A	T	5: 110,330,705		probably benign	Het
Polq	C	A	16: 37,060,343	D956E	probably benign	Het
Polq	T	A	16: 37,060,344	C957S	probably benign	Het
Ppp3cc	G	A	14: 70,266,682	T107I	probably damaging	Het
Prss39	C	A	1: 34,500,199	H173Q	possibly damaging	Het
Reep4	A	G	14: 70,548,488	D256G	probably benign	Het
Rfc3	A	G	5: 151,647,510	V107A	probably damaging	Het
Slc19a3	A	G	1: 83,026,260	L40P	probably damaging	Het
Slc29a4	C	T	5: 142,718,506	P305L	probably benign	Het
Strada	C	A	11: 106,187,094	V15F	unknown	Het
Suco	A	T	1: 161,845,334	S440T	probably damaging	Het
Svep1	A	T	4: 58,090,683	C1595S	probably benign	Het
Synpo	G	T	18: 60,603,494	T460K	probably damaging	Het
Tagap	A	T	17: 7,928,736	I93F	probably damaging	Het
Tmtc3	A	T	10: 100,466,094	F331Y	probably damaging	Het
Tnpo1	A	C	13: 98,870,243	I225M	probably benign	Het
Tollip	A	T	7: 141,892,141	M70K	probably benign	Het
Trpm7	A	T	2: 126,849,922	I171N	probably damaging	Het
Ttc41	G	T	10: 86,713,432	E163D	probably damaging	Het
Vmn2r17	A	T	5: 109,427,829	T189S	probably benign	Het
Vmn2r20	C	T	6: 123,385,423	V801I	probably benign	Het
Vmn2r82	G	A	10: 79,396,008	V614I	possibly damaging	Het
Vmn2r96	G	A	17: 18,582,733	E302K	probably benign	Het
Vwf	T	C	6: 125,642,169	F1270S		Het
Wdr3	A	T	3: 100,151,187	F367L	probably benign	Het
Zfp592	A	G	7: 81,038,340	S1005G	probably damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	161042079	missense	probably benign	0.01
IGL00899:Chd6	APN	2	161029298	splice site	probably benign
IGL01104:Chd6	APN	2	160961927	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160988370	splice site	probably benign
IGL01717:Chd6	APN	2	160965259	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160961374	missense	probably benign	0.00
IGL01814:Chd6	APN	2	161059929	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160983678	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160977512	missense	probably benign
IGL02158:Chd6	APN	2	161026292	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160965675	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160984452	splice site	probably benign
IGL02522:Chd6	APN	2	160965796	missense	probably benign	0.30
IGL02626:Chd6	APN	2	161039350	splice site	probably benign
IGL02727:Chd6	APN	2	160969463	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160965698	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160960263	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160984632	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160990301	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	161019616	nonsense	probably null
IGL02979:Chd6	APN	2	160966170	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	161052384	splice site	probably benign
IGL03277:Chd6	APN	2	160983061	missense	probably null	1.00
IGL03346:Chd6	APN	2	160960362	missense	probably benign	0.00
IGL03357:Chd6	APN	2	161018016	splice site	probably benign
IGL03134:Chd6	UTSW	2	160965483	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160967902	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	161052847	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	161014324	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	161052688	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160992191	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	161019580	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160990271	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	161030802	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160967815	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160983103	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	161042058	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160981667	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160966639	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160990256	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160968000	splice site	probably benign
R1973:Chd6	UTSW	2	160966387	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160983753	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160965759	frame shift	probably null
R2341:Chd6	UTSW	2	160965759	frame shift	probably null
R2519:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160967880	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160966552	small deletion	probably benign
R3426:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160990255	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160988333	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160961291	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160949856	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160965318	missense	probably benign
R4458:Chd6	UTSW	2	161029876	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	161014194	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160969492	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160970183	missense	probably benign
R4765:Chd6	UTSW	2	160966244	nonsense	probably null
R4779:Chd6	UTSW	2	160949557	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	161029299	splice site	probably benign
R5068:Chd6	UTSW	2	160966369	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160949953	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160969363	missense	probably benign
R5405:Chd6	UTSW	2	160965390	missense	probably benign
R5598:Chd6	UTSW	2	161014112	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160965265	missense	probably benign
R5697:Chd6	UTSW	2	161018051	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160949878	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160983762	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160957078	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160957079	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160965827	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160965582	missense	probably benign
R6104:Chd6	UTSW	2	161014132	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160950048	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160979487	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160965498	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	161013067	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160966254	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160960359	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160965730	missense	probably benign
R6895:Chd6	UTSW	2	160988340	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	161013127	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	161025965	nonsense	probably null
R7064:Chd6	UTSW	2	160950063	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160961279	nonsense	probably null
R7287:Chd6	UTSW	2	161008392	missense	probably benign	0.07
R7431:Chd6	UTSW	2	161026328	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160950003	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	161025943	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160966619	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160970175	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160957082	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160990321	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	161019651	missense	probably damaging	1.00
Z1088:Chd6	UTSW	2	160966488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTGTTAAGACCTATGCGAATGG -3'
(R):5'- TGATCCAGCAGAGTCAGGATTC -3'

Sequencing Primer
(F):5'- TGTTAAAGACACACACTGCCTGTAG -3'
(R):5'- CCGAGGAAAAGATTCTGGA -3'

Posted On

2019-10-17