Incidental Mutation 'R7509:Chd6'
ID581936
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R7509 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161013154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 778 (I778N)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000134178]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: I778N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: I778N

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: I777N

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A G 7: 119,534,388 S259G probably benign Het
Adamts16 G T 13: 70,787,164 N436K probably damaging Het
Asb3 T A 11: 30,998,507 M61K probably benign Het
Catspere2 A G 1: 178,077,512 T163A possibly damaging Het
Ccser2 A G 14: 36,938,645 L517P probably damaging Het
Cd226 A G 18: 89,247,071 T158A probably benign Het
Cnga4 T C 7: 105,406,890 V336A probably benign Het
Cpd C T 11: 76,797,876 V857I probably benign Het
Cpm A G 10: 117,659,840 Y78C probably damaging Het
Cst7 A T 2: 150,577,704 T97S probably benign Het
Cttnbp2nl T C 3: 105,032,730 K8E possibly damaging Het
Erbb4 A T 1: 68,250,580 D767E possibly damaging Het
Esyt2 T C 12: 116,365,876 S685P probably damaging Het
Gcfc2 T C 6: 81,953,275 L641P probably damaging Het
Gcnt4 T A 13: 96,947,170 F325I probably benign Het
Glg1 T G 8: 111,259,043 S52R probably benign Het
Gm10577 G A 4: 101,020,651 L16F unknown Het
Gm14326 C T 2: 177,945,700 G501D probably benign Het
Gm1587 G A 14: 77,797,024 P35S unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grrp1 A C 4: 134,252,113 V18G probably damaging Het
Helb T A 10: 120,089,814 H886L probably damaging Het
Hgsnat A G 8: 25,955,726 V380A probably damaging Het
Hmbs T A 9: 44,336,911 R125S Het
Hsd17b4 A T 18: 50,164,682 Y346F probably damaging Het
Inpp4a T C 1: 37,387,830 L624P probably damaging Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Itga11 C T 9: 62,781,940 T1129I probably benign Het
Itih4 G A 14: 30,895,447 V575I probably benign Het
Kcnn2 A G 18: 45,683,120 T473A probably benign Het
Kidins220 T C 12: 24,982,361 V31A probably damaging Het
Lrch1 G A 14: 74,947,608 T18I probably benign Het
Ly6e T C 15: 74,958,286 F30L probably damaging Het
Med13l A G 5: 118,748,930 D1632G probably damaging Het
Mei4 T A 9: 82,025,577 L320Q probably damaging Het
Mlip T G 9: 77,181,396 T197P probably damaging Het
Mon2 G A 10: 123,032,552 A532V probably benign Het
Myh1 C T 11: 67,210,461 P688S probably benign Het
Ncapg G A 5: 45,696,108 D900N probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Ntn4 A G 10: 93,710,568 N361S probably benign Het
Nudt16l1 T A 16: 4,939,218 H26Q probably damaging Het
Obscn G A 11: 59,051,629 T4348I probably benign Het
Olfr898 T A 9: 38,349,572 M157K probably benign Het
Olfr960 T A 9: 39,623,327 I66N probably damaging Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pcdhb7 C A 18: 37,342,021 T70K possibly damaging Het
Pcdhga3 T A 18: 37,675,857 Y454* probably null Het
Pigc A T 1: 161,970,976 T176S probably benign Het
Pola2 A T 19: 5,961,166 S43R probably benign Het
Pole A T 5: 110,330,705 probably benign Het
Polq C A 16: 37,060,343 D956E probably benign Het
Polq T A 16: 37,060,344 C957S probably benign Het
Ppp3cc G A 14: 70,266,682 T107I probably damaging Het
Prss39 C A 1: 34,500,199 H173Q possibly damaging Het
Reep4 A G 14: 70,548,488 D256G probably benign Het
Rfc3 A G 5: 151,647,510 V107A probably damaging Het
Slc19a3 A G 1: 83,026,260 L40P probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Strada C A 11: 106,187,094 V15F unknown Het
Suco A T 1: 161,845,334 S440T probably damaging Het
Svep1 A T 4: 58,090,683 C1595S probably benign Het
Synpo G T 18: 60,603,494 T460K probably damaging Het
Tagap A T 17: 7,928,736 I93F probably damaging Het
Tmtc3 A T 10: 100,466,094 F331Y probably damaging Het
Tnpo1 A C 13: 98,870,243 I225M probably benign Het
Tollip A T 7: 141,892,141 M70K probably benign Het
Trpm7 A T 2: 126,849,922 I171N probably damaging Het
Ttc41 G T 10: 86,713,432 E163D probably damaging Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Vmn2r20 C T 6: 123,385,423 V801I probably benign Het
Vmn2r82 G A 10: 79,396,008 V614I possibly damaging Het
Vmn2r96 G A 17: 18,582,733 E302K probably benign Het
Vwf T C 6: 125,642,169 F1270S Het
Wdr3 A T 3: 100,151,187 F367L probably benign Het
Zfp592 A G 7: 81,038,340 S1005G probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160950003 missense probably damaging 1.00
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGTTAAGACCTATGCGAATGG -3'
(R):5'- TGATCCAGCAGAGTCAGGATTC -3'

Sequencing Primer
(F):5'- TGTTAAAGACACACACTGCCTGTAG -3'
(R):5'- CCGAGGAAAAGATTCTGGA -3'
Posted On2019-10-17