Incidental Mutation 'R7509:Acsm5'
ID581956
Institutional Source Beutler Lab
Gene Symbol Acsm5
Ensembl Gene ENSMUSG00000030972
Gene Nameacyl-CoA synthetase medium-chain family member 5
SynonymsC730027J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R7509 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119519463-119545551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119534388 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 259 (S259G)
Ref Sequence ENSEMBL: ENSMUSP00000147176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066465] [ENSMUST00000207307] [ENSMUST00000207381] [ENSMUST00000207387] [ENSMUST00000207440] [ENSMUST00000207796] [ENSMUST00000207813]
Predicted Effect probably benign
Transcript: ENSMUST00000066465
SMART Domains Protein: ENSMUSP00000063416
Gene: ENSMUSG00000030972

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
Pfam:AMP-binding 65 477 2.9e-78 PFAM
Pfam:AMP-binding_C 485 565 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207307
AA Change: S259G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207381
Predicted Effect probably benign
Transcript: ENSMUST00000207387
Predicted Effect probably benign
Transcript: ENSMUST00000207440
Predicted Effect probably benign
Transcript: ENSMUST00000207796
Predicted Effect probably benign
Transcript: ENSMUST00000207813
AA Change: S259G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G T 13: 70,787,164 N436K probably damaging Het
Asb3 T A 11: 30,998,507 M61K probably benign Het
Catspere2 A G 1: 178,077,512 T163A possibly damaging Het
Ccser2 A G 14: 36,938,645 L517P probably damaging Het
Cd226 A G 18: 89,247,071 T158A probably benign Het
Chd6 A T 2: 161,013,154 I778N probably damaging Het
Cnga4 T C 7: 105,406,890 V336A probably benign Het
Cpd C T 11: 76,797,876 V857I probably benign Het
Cpm A G 10: 117,659,840 Y78C probably damaging Het
Cst7 A T 2: 150,577,704 T97S probably benign Het
Cttnbp2nl T C 3: 105,032,730 K8E possibly damaging Het
Erbb4 A T 1: 68,250,580 D767E possibly damaging Het
Esyt2 T C 12: 116,365,876 S685P probably damaging Het
Gcfc2 T C 6: 81,953,275 L641P probably damaging Het
Gcnt4 T A 13: 96,947,170 F325I probably benign Het
Glg1 T G 8: 111,259,043 S52R probably benign Het
Gm10577 G A 4: 101,020,651 L16F unknown Het
Gm14326 C T 2: 177,945,700 G501D probably benign Het
Gm1587 G A 14: 77,797,024 P35S unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grrp1 A C 4: 134,252,113 V18G probably damaging Het
Helb T A 10: 120,089,814 H886L probably damaging Het
Hgsnat A G 8: 25,955,726 V380A probably damaging Het
Hmbs T A 9: 44,336,911 R125S Het
Hsd17b4 A T 18: 50,164,682 Y346F probably damaging Het
Inpp4a T C 1: 37,387,830 L624P probably damaging Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Itga11 C T 9: 62,781,940 T1129I probably benign Het
Itih4 G A 14: 30,895,447 V575I probably benign Het
Kcnn2 A G 18: 45,683,120 T473A probably benign Het
Kidins220 T C 12: 24,982,361 V31A probably damaging Het
Lrch1 G A 14: 74,947,608 T18I probably benign Het
Ly6e T C 15: 74,958,286 F30L probably damaging Het
Med13l A G 5: 118,748,930 D1632G probably damaging Het
Mei4 T A 9: 82,025,577 L320Q probably damaging Het
Mlip T G 9: 77,181,396 T197P probably damaging Het
Mon2 G A 10: 123,032,552 A532V probably benign Het
Myh1 C T 11: 67,210,461 P688S probably benign Het
Ncapg G A 5: 45,696,108 D900N probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Ntn4 A G 10: 93,710,568 N361S probably benign Het
Nudt16l1 T A 16: 4,939,218 H26Q probably damaging Het
Obscn G A 11: 59,051,629 T4348I probably benign Het
Olfr898 T A 9: 38,349,572 M157K probably benign Het
Olfr960 T A 9: 39,623,327 I66N probably damaging Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pcdhb7 C A 18: 37,342,021 T70K possibly damaging Het
Pcdhga3 T A 18: 37,675,857 Y454* probably null Het
Pigc A T 1: 161,970,976 T176S probably benign Het
Pola2 A T 19: 5,961,166 S43R probably benign Het
Pole A T 5: 110,330,705 probably benign Het
Polq C A 16: 37,060,343 D956E probably benign Het
Polq T A 16: 37,060,344 C957S probably benign Het
Ppp3cc G A 14: 70,266,682 T107I probably damaging Het
Prss39 C A 1: 34,500,199 H173Q possibly damaging Het
Reep4 A G 14: 70,548,488 D256G probably benign Het
Rfc3 A G 5: 151,647,510 V107A probably damaging Het
Slc19a3 A G 1: 83,026,260 L40P probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Strada C A 11: 106,187,094 V15F unknown Het
Suco A T 1: 161,845,334 S440T probably damaging Het
Svep1 A T 4: 58,090,683 C1595S probably benign Het
Synpo G T 18: 60,603,494 T460K probably damaging Het
Tagap A T 17: 7,928,736 I93F probably damaging Het
Tmtc3 A T 10: 100,466,094 F331Y probably damaging Het
Tnpo1 A C 13: 98,870,243 I225M probably benign Het
Tollip A T 7: 141,892,141 M70K probably benign Het
Trpm7 A T 2: 126,849,922 I171N probably damaging Het
Ttc41 G T 10: 86,713,432 E163D probably damaging Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Vmn2r20 C T 6: 123,385,423 V801I probably benign Het
Vmn2r82 G A 10: 79,396,008 V614I possibly damaging Het
Vmn2r96 G A 17: 18,582,733 E302K probably benign Het
Vwf T C 6: 125,642,169 F1270S Het
Wdr3 A T 3: 100,151,187 F367L probably benign Het
Zfp592 A G 7: 81,038,340 S1005G probably damaging Het
Other mutations in Acsm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Acsm5 APN 7 119542438 critical splice donor site probably null
IGL01662:Acsm5 APN 7 119538288 missense probably damaging 1.00
IGL02228:Acsm5 APN 7 119531866 missense probably damaging 1.00
IGL02380:Acsm5 APN 7 119537286 missense probably benign 0.05
IGL02709:Acsm5 APN 7 119534818 nonsense probably null
P4717OSA:Acsm5 UTSW 7 119531972 missense probably benign 0.12
R0506:Acsm5 UTSW 7 119538096 nonsense probably null
R0518:Acsm5 UTSW 7 119535800 missense possibly damaging 0.95
R0866:Acsm5 UTSW 7 119540900 missense probably damaging 0.99
R1171:Acsm5 UTSW 7 119540852 missense probably damaging 0.99
R2362:Acsm5 UTSW 7 119528426 start gained probably benign
R2511:Acsm5 UTSW 7 119530454 missense possibly damaging 0.80
R4670:Acsm5 UTSW 7 119531760 splice site probably null
R4908:Acsm5 UTSW 7 119538091 missense probably damaging 1.00
R4913:Acsm5 UTSW 7 119534343 missense probably damaging 0.98
R5038:Acsm5 UTSW 7 119534811 missense probably damaging 1.00
R5112:Acsm5 UTSW 7 119537279 missense possibly damaging 0.95
R6337:Acsm5 UTSW 7 119534235 missense probably benign 0.00
R6481:Acsm5 UTSW 7 119534881 missense probably benign 0.02
R7268:Acsm5 UTSW 7 119537288 missense probably benign 0.38
R7275:Acsm5 UTSW 7 119537288 missense possibly damaging 0.81
R7794:Acsm5 UTSW 7 119538129 unclassified probably benign
R8021:Acsm5 UTSW 7 119542393 missense possibly damaging 0.72
R8178:Acsm5 UTSW 7 119542395 missense probably damaging 1.00
Z1088:Acsm5 UTSW 7 119537211 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATCTTTGGGACTGCTTGG -3'
(R):5'- TTGTGTCATAGCCTAGGAAGACAAG -3'

Sequencing Primer
(F):5'- GGGTGTTGTTTTAAGTTTCTCTTCC -3'
(R):5'- TCATAGCCTAGGAAGACAAGTTAAAG -3'
Posted On2019-10-17