Mutagenetix > Incidental Mutation

Incidental Mutation 'R0008:Sec24d'

58196

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

038303-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0008 (G1)

Quality Score

108

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 123350876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably benign
Transcript: ENSMUST00000047923

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200309

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

98% (109/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 138,176,585	K118R	possibly damaging	Het
Adtrp	T	C	13: 41,767,465	T88A	probably damaging	Het
Afap1l1	A	G	18: 61,756,905	S87P	probably benign	Het
Ankrd27	A	G	7: 35,603,700	K196R	probably benign	Het
Apoe	G	A	7: 19,697,080	T79M	probably damaging	Het
Arrdc3	T	A	13: 80,883,892	Y81*	probably null	Het
Arrdc3	T	A	13: 80,891,075	I75N	probably damaging	Het
Asah2	T	A	19: 32,003,731	K629*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
C130074G19Rik	A	G	1: 184,882,922	S24P	probably benign	Het
C87436	A	G	6: 86,446,283		probably benign	Het
Calcrl	T	C	2: 84,373,274	D54G	probably benign	Het
Clcn2	T	C	16: 20,710,390	N367S	probably null	Het
Cnot1	G	T	8: 95,761,341	D562E	probably damaging	Het
Commd6	G	A	14: 101,640,273		probably benign	Het
Cox6a2	G	A	7: 128,206,040		probably benign	Het
Cp	T	A	3: 19,968,123	Y230N	probably damaging	Het
Dclre1c	T	C	2: 3,437,995	V64A	probably damaging	Het
Eng	T	C	2: 32,677,680	V110A	probably damaging	Het
Esyt3	T	C	9: 99,338,807	I114M	possibly damaging	Het
Fam83h	A	T	15: 76,003,962	Y509N	probably damaging	Het
Fat2	A	T	11: 55,311,249	L333H	probably damaging	Het
Fbxo21	A	G	5: 118,008,013	N567S	possibly damaging	Het
Fn1	A	T	1: 71,595,720	L1964Q	probably damaging	Het
Fuk	T	C	8: 110,884,233		probably benign	Het
Gorasp1	G	T	9: 119,928,246	S353R	possibly damaging	Het
Grk2	C	T	19: 4,287,234	E646K	probably damaging	Het
Hoxc11	T	C	15: 102,954,962	V146A	probably damaging	Het
Igf2bp2	T	C	16: 22,076,091	T301A	probably benign	Het
Il11	T	C	7: 4,773,659	S111G	probably benign	Het
Ist1	A	T	8: 109,676,786	I273K	probably benign	Het
Kdm2b	G	A	5: 122,881,743	S738L	probably benign	Het
Lrp2	T	A	2: 69,516,551	N784Y	probably benign	Het
Lrp6	T	C	6: 134,485,753	E648G	probably damaging	Het
Mapk15	G	A	15: 75,998,254	E408K	probably benign	Het
Mdn1	T	A	4: 32,718,317	F2191I	possibly damaging	Het
Metrn	C	A	17: 25,796,505	V79F	possibly damaging	Het
Mtbp	T	A	15: 55,586,493		probably benign	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myo3a	T	A	2: 22,579,741	I508N	probably damaging	Het
Nat9	A	T	11: 115,185,115	Y27N	probably damaging	Het
Ncapg2	T	C	12: 116,429,835	F553S	probably damaging	Het
Nipsnap3b	T	A	4: 53,015,112	L53Q	probably damaging	Het
Nlrp3	A	T	11: 59,558,448	H852L	probably benign	Het
Olfr1251	T	A	2: 89,667,084	K267N	probably damaging	Het
Olfr1484	A	G	19: 13,585,876	I191V	probably benign	Het
Olfr1532-ps1	A	G	7: 106,915,019	I274V	probably benign	Het
Olfr594	A	T	7: 103,220,351	D211V	probably damaging	Het
Olfr594	G	A	7: 103,220,377	A220T	probably benign	Het
Olfr720	T	A	14: 14,176,092		probably benign	Het
Pax9	A	G	12: 56,709,743	T289A	probably benign	Het
Pcyt2	A	T	11: 120,615,869	I53N	possibly damaging	Het
Pdlim4	C	T	11: 54,055,049	V327M	probably damaging	Het
Pdzph1	T	A	17: 58,922,761		probably benign	Het
Plekhm2	C	T	4: 141,642,393		probably benign	Het
Ppt1	T	C	4: 122,848,423		probably benign	Het
Prdm1	C	T	10: 44,441,679	E398K	probably damaging	Het
Prep	T	C	10: 45,115,078	V280A	probably benign	Het
Prkdc	T	A	16: 15,708,701		probably benign	Het
Proser3	G	A	7: 30,540,138	R514C	probably damaging	Het
Ptk7	G	A	17: 46,572,762		probably benign	Het
Rbm45	T	C	2: 76,378,398	Y293H	probably damaging	Het
Rnf213	A	C	11: 119,465,052	E4108A	possibly damaging	Het
Sdk2	A	G	11: 113,856,755	L643P	probably damaging	Het
Sh2d3c	C	G	2: 32,753,021	H587D	probably damaging	Het
Slc1a1	G	A	19: 28,901,484	G208S	probably benign	Het
Slc35b4	A	T	6: 34,158,517	Y287N	probably damaging	Het
Slc46a2	T	A	4: 59,914,544	L126F	probably damaging	Het
Slc4a8	T	C	15: 100,800,493	M621T	possibly damaging	Het
Slc9b2	T	A	3: 135,336,508	V516D	possibly damaging	Het
Slco1a6	T	A	6: 142,157,222		probably benign	Het
Sncg	C	T	14: 34,374,538	V15I	probably benign	Het
Srgap2	T	C	1: 131,355,564	T260A	probably damaging	Het
Stk10	T	A	11: 32,587,305		probably benign	Het
Taf5	A	G	19: 47,075,862	S415G	possibly damaging	Het
Tdp1	C	T	12: 99,954,958		probably benign	Het
Tdp2	T	G	13: 24,841,350		probably null	Het
Tgfbi	T	A	13: 56,629,774	I357N	probably benign	Het
Tmem116	A	G	5: 121,495,096	T178A	probably damaging	Het
Tnrc6a	G	A	7: 123,170,394	R469H	probably benign	Het
Top2a	A	T	11: 99,002,903	L1055*	probably null	Het
Tox	T	A	4: 6,842,411	M40L	probably benign	Het
Trib2	A	T	12: 15,809,929	H110Q	probably benign	Het
Trpa1	A	G	1: 14,903,215	I293T	possibly damaging	Het
Trpv2	A	G	11: 62,590,260	Y395C	probably damaging	Het
Ubn2	T	A	6: 38,434,600		probably null	Het
Ubr4	C	T	4: 139,430,176	T2348M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn1r33	C	A	6: 66,612,526	G15*	probably null	Het
Vmn1r37	T	A	6: 66,731,785	S95T	probably benign	Het
Vmn2r57	A	G	7: 41,400,652	C558R	probably damaging	Het
Vnn1	T	C	10: 23,898,602		probably null	Het
Vps13c	T	C	9: 67,919,262	V1395A	probably benign	Het
Vwa7	A	G	17: 35,019,805	I290V	probably benign	Het
Wdr93	A	G	7: 79,758,473	E234G	probably damaging	Het
Zfp385b	A	T	2: 77,415,947	S245R	probably benign	Het
Zfp942	A	T	17: 21,928,338	C437S	probably damaging	Het
Zfyve9	T	A	4: 108,718,705	E393V	possibly damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGACTGAATGCACACACCTCTG -3'
(R):5'- TGCCTTGCCCATCTGAAGCAAC -3'

Sequencing Primer
(F):5'- GGCTACTGGAGTATCAAATAACCTG -3'
(R):5'- AGCAACACATGTGTGCACAC -3'

Posted On

2013-07-11