Incidental Mutation 'R7509:Itga11'
ID581963
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7509 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62781940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1129 (T1129I)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: T1129I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: T1129I

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 A G 7: 119,534,388 S259G probably benign Het
Adamts16 G T 13: 70,787,164 N436K probably damaging Het
Asb3 T A 11: 30,998,507 M61K probably benign Het
Catspere2 A G 1: 178,077,512 T163A possibly damaging Het
Ccser2 A G 14: 36,938,645 L517P probably damaging Het
Cd226 A G 18: 89,247,071 T158A probably benign Het
Chd6 A T 2: 161,013,154 I778N probably damaging Het
Cnga4 T C 7: 105,406,890 V336A probably benign Het
Cpd C T 11: 76,797,876 V857I probably benign Het
Cpm A G 10: 117,659,840 Y78C probably damaging Het
Cst7 A T 2: 150,577,704 T97S probably benign Het
Cttnbp2nl T C 3: 105,032,730 K8E possibly damaging Het
Erbb4 A T 1: 68,250,580 D767E possibly damaging Het
Esyt2 T C 12: 116,365,876 S685P probably damaging Het
Gcfc2 T C 6: 81,953,275 L641P probably damaging Het
Gcnt4 T A 13: 96,947,170 F325I probably benign Het
Glg1 T G 8: 111,259,043 S52R probably benign Het
Gm10577 G A 4: 101,020,651 L16F unknown Het
Gm14326 C T 2: 177,945,700 G501D probably benign Het
Gm1587 G A 14: 77,797,024 P35S unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grrp1 A C 4: 134,252,113 V18G probably damaging Het
Helb T A 10: 120,089,814 H886L probably damaging Het
Hgsnat A G 8: 25,955,726 V380A probably damaging Het
Hmbs T A 9: 44,336,911 R125S Het
Hsd17b4 A T 18: 50,164,682 Y346F probably damaging Het
Inpp4a T C 1: 37,387,830 L624P probably damaging Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Itih4 G A 14: 30,895,447 V575I probably benign Het
Kcnn2 A G 18: 45,683,120 T473A probably benign Het
Kidins220 T C 12: 24,982,361 V31A probably damaging Het
Lrch1 G A 14: 74,947,608 T18I probably benign Het
Ly6e T C 15: 74,958,286 F30L probably damaging Het
Med13l A G 5: 118,748,930 D1632G probably damaging Het
Mei4 T A 9: 82,025,577 L320Q probably damaging Het
Mlip T G 9: 77,181,396 T197P probably damaging Het
Mon2 G A 10: 123,032,552 A532V probably benign Het
Myh1 C T 11: 67,210,461 P688S probably benign Het
Ncapg G A 5: 45,696,108 D900N probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Ntn4 A G 10: 93,710,568 N361S probably benign Het
Nudt16l1 T A 16: 4,939,218 H26Q probably damaging Het
Obscn G A 11: 59,051,629 T4348I probably benign Het
Olfr898 T A 9: 38,349,572 M157K probably benign Het
Olfr960 T A 9: 39,623,327 I66N probably damaging Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pcdhb7 C A 18: 37,342,021 T70K possibly damaging Het
Pcdhga3 T A 18: 37,675,857 Y454* probably null Het
Pigc A T 1: 161,970,976 T176S probably benign Het
Pola2 A T 19: 5,961,166 S43R probably benign Het
Pole A T 5: 110,330,705 probably benign Het
Polq C A 16: 37,060,343 D956E probably benign Het
Polq T A 16: 37,060,344 C957S probably benign Het
Ppp3cc G A 14: 70,266,682 T107I probably damaging Het
Prss39 C A 1: 34,500,199 H173Q possibly damaging Het
Reep4 A G 14: 70,548,488 D256G probably benign Het
Rfc3 A G 5: 151,647,510 V107A probably damaging Het
Slc19a3 A G 1: 83,026,260 L40P probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Strada C A 11: 106,187,094 V15F unknown Het
Suco A T 1: 161,845,334 S440T probably damaging Het
Svep1 A T 4: 58,090,683 C1595S probably benign Het
Synpo G T 18: 60,603,494 T460K probably damaging Het
Tagap A T 17: 7,928,736 I93F probably damaging Het
Tmtc3 A T 10: 100,466,094 F331Y probably damaging Het
Tnpo1 A C 13: 98,870,243 I225M probably benign Het
Tollip A T 7: 141,892,141 M70K probably benign Het
Trpm7 A T 2: 126,849,922 I171N probably damaging Het
Ttc41 G T 10: 86,713,432 E163D probably damaging Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Vmn2r20 C T 6: 123,385,423 V801I probably benign Het
Vmn2r82 G A 10: 79,396,008 V614I possibly damaging Het
Vmn2r96 G A 17: 18,582,733 E302K probably benign Het
Vwf T C 6: 125,642,169 F1270S Het
Wdr3 A T 3: 100,151,187 F367L probably benign Het
Zfp592 A G 7: 81,038,340 S1005G probably damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8263:Itga11 UTSW 9 62696980 missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8419:Itga11 UTSW 9 62755178 missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
R8475:Itga11 UTSW 9 62744045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGTTCACGCAGTTAGAG -3'
(R):5'- GGCAAGCACTTGAAGGAGTC -3'

Sequencing Primer
(F):5'- TTCACGCAGTTAGAGGTCAGC -3'
(R):5'- CACTTGAAGGAGTCTGCAGTGC -3'
Posted On2019-10-17