Mutagenetix > Incidental Mutations

Incidental Mutation 'R7509:Itga11'

581963

Institutional Source

Beutler Lab

Gene Symbol

Itga11

Ensembl Gene

ENSMUSG00000032243

Gene Name

integrin alpha 11

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7509 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62677826-62783982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62781940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1129 (T1129I)

Ref Sequence

ENSEMBL: ENSMUSP00000034774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034774]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000034774
AA Change: T1129I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: T1129I

Domain	Start	End	E-Value	Type
Int_alpha	37	90	3.9e-7	SMART
VWA	162	350	2.74e-38	SMART
Int_alpha	421	472	2.19e-1	SMART
Int_alpha	476	532	3.75e-9	SMART
Int_alpha	538	593	1.39e-12	SMART
Int_alpha	600	654	1.08e0	SMART
transmembrane domain	1142	1164	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	A	G	7: 119,534,388	S259G	probably benign	Het
Adamts16	G	T	13: 70,787,164	N436K	probably damaging	Het
Asb3	T	A	11: 30,998,507	M61K	probably benign	Het
Catspere2	A	G	1: 178,077,512	T163A	possibly damaging	Het
Ccser2	A	G	14: 36,938,645	L517P	probably damaging	Het
Cd226	A	G	18: 89,247,071	T158A	probably benign	Het
Chd6	A	T	2: 161,013,154	I778N	probably damaging	Het
Cnga4	T	C	7: 105,406,890	V336A	probably benign	Het
Cpd	C	T	11: 76,797,876	V857I	probably benign	Het
Cpm	A	G	10: 117,659,840	Y78C	probably damaging	Het
Cst7	A	T	2: 150,577,704	T97S	probably benign	Het
Cttnbp2nl	T	C	3: 105,032,730	K8E	possibly damaging	Het
Erbb4	A	T	1: 68,250,580	D767E	possibly damaging	Het
Esyt2	T	C	12: 116,365,876	S685P	probably damaging	Het
Gcfc2	T	C	6: 81,953,275	L641P	probably damaging	Het
Gcnt4	T	A	13: 96,947,170	F325I	probably benign	Het
Glg1	T	G	8: 111,259,043	S52R	probably benign	Het
Gm10577	G	A	4: 101,020,651	L16F	unknown	Het
Gm14326	C	T	2: 177,945,700	G501D	probably benign	Het
Gm1587	G	A	14: 77,797,024	P35S	unknown	Het
Gpd1	G	A	15: 99,722,086	S255N	probably damaging	Het
Grrp1	A	C	4: 134,252,113	V18G	probably damaging	Het
Helb	T	A	10: 120,089,814	H886L	probably damaging	Het
Hgsnat	A	G	8: 25,955,726	V380A	probably damaging	Het
Hmbs	T	A	9: 44,336,911	R125S		Het
Hsd17b4	A	T	18: 50,164,682	Y346F	probably damaging	Het
Inpp4a	T	C	1: 37,387,830	L624P	probably damaging	Het
Irak2	AC	ACC	6: 113,690,898		probably null	Het
Itih4	G	A	14: 30,895,447	V575I	probably benign	Het
Kcnn2	A	G	18: 45,683,120	T473A	probably benign	Het
Kidins220	T	C	12: 24,982,361	V31A	probably damaging	Het
Lrch1	G	A	14: 74,947,608	T18I	probably benign	Het
Ly6e	T	C	15: 74,958,286	F30L	probably damaging	Het
Med13l	A	G	5: 118,748,930	D1632G	probably damaging	Het
Mei4	T	A	9: 82,025,577	L320Q	probably damaging	Het
Mlip	T	G	9: 77,181,396	T197P	probably damaging	Het
Mon2	G	A	10: 123,032,552	A532V	probably benign	Het
Myh1	C	T	11: 67,210,461	P688S	probably benign	Het
Ncapg	G	A	5: 45,696,108	D900N	probably benign	Het
Neurl1b	C	G	17: 26,438,746	H219Q	probably benign	Het
Ntn4	A	G	10: 93,710,568	N361S	probably benign	Het
Nudt16l1	T	A	16: 4,939,218	H26Q	probably damaging	Het
Obscn	G	A	11: 59,051,629	T4348I	probably benign	Het
Olfr898	T	A	9: 38,349,572	M157K	probably benign	Het
Olfr960	T	A	9: 39,623,327	I66N	probably damaging	Het
Pcdh7	T	A	5: 57,720,187	D361E	probably damaging	Het
Pcdhb7	C	A	18: 37,342,021	T70K	possibly damaging	Het
Pcdhga3	T	A	18: 37,675,857	Y454*	probably null	Het
Pigc	A	T	1: 161,970,976	T176S	probably benign	Het
Pola2	A	T	19: 5,961,166	S43R	probably benign	Het
Pole	A	T	5: 110,330,705		probably benign	Het
Polq	C	A	16: 37,060,343	D956E	probably benign	Het
Polq	T	A	16: 37,060,344	C957S	probably benign	Het
Ppp3cc	G	A	14: 70,266,682	T107I	probably damaging	Het
Prss39	C	A	1: 34,500,199	H173Q	possibly damaging	Het
Reep4	A	G	14: 70,548,488	D256G	probably benign	Het
Rfc3	A	G	5: 151,647,510	V107A	probably damaging	Het
Slc19a3	A	G	1: 83,026,260	L40P	probably damaging	Het
Slc29a4	C	T	5: 142,718,506	P305L	probably benign	Het
Strada	C	A	11: 106,187,094	V15F	unknown	Het
Suco	A	T	1: 161,845,334	S440T	probably damaging	Het
Svep1	A	T	4: 58,090,683	C1595S	probably benign	Het
Synpo	G	T	18: 60,603,494	T460K	probably damaging	Het
Tagap	A	T	17: 7,928,736	I93F	probably damaging	Het
Tmtc3	A	T	10: 100,466,094	F331Y	probably damaging	Het
Tnpo1	A	C	13: 98,870,243	I225M	probably benign	Het
Tollip	A	T	7: 141,892,141	M70K	probably benign	Het
Trpm7	A	T	2: 126,849,922	I171N	probably damaging	Het
Ttc41	G	T	10: 86,713,432	E163D	probably damaging	Het
Vmn2r17	A	T	5: 109,427,829	T189S	probably benign	Het
Vmn2r20	C	T	6: 123,385,423	V801I	probably benign	Het
Vmn2r82	G	A	10: 79,396,008	V614I	possibly damaging	Het
Vmn2r96	G	A	17: 18,582,733	E302K	probably benign	Het
Vwf	T	C	6: 125,642,169	F1270S		Het
Wdr3	A	T	3: 100,151,187	F367L	probably benign	Het
Zfp592	A	G	7: 81,038,340	S1005G	probably damaging	Het

Other mutations in Itga11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Itga11	APN	9	62769305	missense	possibly damaging	0.58
IGL01108:Itga11	APN	9	62757621	missense	probably benign
IGL01348:Itga11	APN	9	62744579	missense	possibly damaging	0.83
IGL01739:Itga11	APN	9	62774117	missense	probably benign	0.03
IGL01918:Itga11	APN	9	62772996	missense	probably benign	0.05
IGL02237:Itga11	APN	9	62755775	critical splice donor site	probably null
IGL02418:Itga11	APN	9	62744632	missense	probably benign	0.30
IGL02451:Itga11	APN	9	62735353	missense	probably damaging	1.00
sneezy	UTSW	9	62732109	missense	probably damaging	1.00
PIT4812001:Itga11	UTSW	9	62732193	missense	probably damaging	1.00
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0013:Itga11	UTSW	9	62776613	missense	possibly damaging	0.89
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0032:Itga11	UTSW	9	62774095	missense	probably benign	0.05
R0101:Itga11	UTSW	9	62744486	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62735293	missense	probably damaging	1.00
R0114:Itga11	UTSW	9	62760302	missense	possibly damaging	0.85
R0212:Itga11	UTSW	9	62745969	missense	probably benign	0.22
R0310:Itga11	UTSW	9	62760346	missense	probably damaging	1.00
R0455:Itga11	UTSW	9	62696961	missense	probably damaging	1.00
R0558:Itga11	UTSW	9	62752288	missense	probably benign	0.01
R0607:Itga11	UTSW	9	62774371	missense	probably benign	0.00
R0924:Itga11	UTSW	9	62776674	missense	probably benign	0.14
R1085:Itga11	UTSW	9	62677970	missense	probably benign	0.03
R1477:Itga11	UTSW	9	62755211	missense	probably benign
R1647:Itga11	UTSW	9	62760370	missense	probably benign	0.01
R1831:Itga11	UTSW	9	62782018	missense	probably damaging	1.00
R1880:Itga11	UTSW	9	62677949	missense	probably benign	0.06
R1934:Itga11	UTSW	9	62744514	missense	probably damaging	1.00
R2025:Itga11	UTSW	9	62762811	missense	probably damaging	1.00
R2046:Itga11	UTSW	9	62727697	missense	probably damaging	1.00
R2145:Itga11	UTSW	9	62732204	splice site	probably benign
R2922:Itga11	UTSW	9	62768630	splice site	probably benign
R3011:Itga11	UTSW	9	62696980	missense	probably damaging	0.99
R3158:Itga11	UTSW	9	62769278	missense	probably benign	0.02
R3809:Itga11	UTSW	9	62771382	missense	probably benign
R3836:Itga11	UTSW	9	62769283	missense	probably benign	0.00
R4051:Itga11	UTSW	9	62755651	nonsense	probably null
R4190:Itga11	UTSW	9	62732109	missense	probably damaging	1.00
R4510:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4511:Itga11	UTSW	9	62761588	missense	probably damaging	0.96
R4678:Itga11	UTSW	9	62735357	missense	probably damaging	0.98
R4706:Itga11	UTSW	9	62755296	missense	possibly damaging	0.64
R4713:Itga11	UTSW	9	62765788	missense	probably damaging	1.00
R4798:Itga11	UTSW	9	62776727	splice site	probably null
R4909:Itga11	UTSW	9	62755299	missense	probably damaging	1.00
R4915:Itga11	UTSW	9	62752248	nonsense	probably null
R4957:Itga11	UTSW	9	62767648	missense	probably benign	0.00
R4962:Itga11	UTSW	9	62761568	nonsense	probably null
R5081:Itga11	UTSW	9	62755196	missense	probably benign	0.13
R5265:Itga11	UTSW	9	62737412	missense	probably benign	0.05
R5308:Itga11	UTSW	9	62755769	missense	probably benign
R5398:Itga11	UTSW	9	62745923	missense	probably benign	0.21
R5717:Itga11	UTSW	9	62752249	missense	probably benign	0.26
R5885:Itga11	UTSW	9	62762850	missense	probably damaging	0.99
R5996:Itga11	UTSW	9	62755673	missense	probably benign	0.01
R6394:Itga11	UTSW	9	62735266	splice site	probably null
R6751:Itga11	UTSW	9	62768584	missense	probably benign	0.02
R7041:Itga11	UTSW	9	62752256	missense	probably damaging	1.00
R7264:Itga11	UTSW	9	62745908	missense	probably benign	0.02
R7601:Itga11	UTSW	9	62696926	missense	probably benign	0.18
R7615:Itga11	UTSW	9	62744018	missense	probably benign	0.00
R8263:Itga11	UTSW	9	62696980	missense	possibly damaging	0.86
R8285:Itga11	UTSW	9	62752258	missense	probably damaging	1.00
R8419:Itga11	UTSW	9	62755178	missense	possibly damaging	0.59
R8422:Itga11	UTSW	9	62767678	missense	probably benign	0.00
R8469:Itga11	UTSW	9	62771398	missense	probably benign	0.00
R8475:Itga11	UTSW	9	62744045	missense	probably damaging	1.00
R8871:Itga11	UTSW	9	62761541	nonsense	probably null
R8904:Itga11	UTSW	9	62757611	missense	probably benign
R8954:Itga11	UTSW	9	62769263	missense	possibly damaging	0.58
R8977:Itga11	UTSW	9	62755640	missense	probably damaging	0.98
R9011:Itga11	UTSW	9	62755627	missense	probably benign	0.43
R9038:Itga11	UTSW	9	62767757	missense	possibly damaging	0.90
R9089:Itga11	UTSW	9	62771380	missense	probably damaging	1.00
R9327:Itga11	UTSW	9	62730752	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGTTCACGCAGTTAGAG -3'
(R):5'- GGCAAGCACTTGAAGGAGTC -3'

Sequencing Primer
(F):5'- TTCACGCAGTTAGAGGTCAGC -3'
(R):5'- CACTTGAAGGAGTCTGCAGTGC -3'

Posted On

2019-10-17