Incidental Mutation 'R0008:Slc9b2'
Institutional Source Beutler Lab
Gene Symbol Slc9b2
Ensembl Gene ENSMUSG00000037994
Gene Namesolute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
SynonymsC80638, nha-oc, Nhedc2, NHE10, NHA2
MMRRC Submission 038303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0008 (G1)
Quality Score225
Status Validated
Chromosomal Location135307700-135345387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135336508 bp
Amino Acid Change Valine to Aspartic acid at position 516 (V516D)
Ref Sequence ENSEMBL: ENSMUSP00000060640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051849
AA Change: V516D

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: V516D

transmembrane domain 83 102 N/A INTRINSIC
Pfam:Na_H_Exchanger 116 515 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132405
Predicted Effect probably benign
Transcript: ENSMUST00000145195
SMART Domains Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,585 K118R possibly damaging Het
Adtrp T C 13: 41,767,465 T88A probably damaging Het
Afap1l1 A G 18: 61,756,905 S87P probably benign Het
Ankrd27 A G 7: 35,603,700 K196R probably benign Het
Apoe G A 7: 19,697,080 T79M probably damaging Het
Arrdc3 T A 13: 80,883,892 Y81* probably null Het
Arrdc3 T A 13: 80,891,075 I75N probably damaging Het
Asah2 T A 19: 32,003,731 K629* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
C130074G19Rik A G 1: 184,882,922 S24P probably benign Het
C87436 A G 6: 86,446,283 probably benign Het
Calcrl T C 2: 84,373,274 D54G probably benign Het
Clcn2 T C 16: 20,710,390 N367S probably null Het
Cnot1 G T 8: 95,761,341 D562E probably damaging Het
Commd6 G A 14: 101,640,273 probably benign Het
Cox6a2 G A 7: 128,206,040 probably benign Het
Cp T A 3: 19,968,123 Y230N probably damaging Het
Dclre1c T C 2: 3,437,995 V64A probably damaging Het
Eng T C 2: 32,677,680 V110A probably damaging Het
Esyt3 T C 9: 99,338,807 I114M possibly damaging Het
Fam83h A T 15: 76,003,962 Y509N probably damaging Het
Fat2 A T 11: 55,311,249 L333H probably damaging Het
Fbxo21 A G 5: 118,008,013 N567S possibly damaging Het
Fn1 A T 1: 71,595,720 L1964Q probably damaging Het
Fuk T C 8: 110,884,233 probably benign Het
Gorasp1 G T 9: 119,928,246 S353R possibly damaging Het
Grk2 C T 19: 4,287,234 E646K probably damaging Het
Hoxc11 T C 15: 102,954,962 V146A probably damaging Het
Igf2bp2 T C 16: 22,076,091 T301A probably benign Het
Il11 T C 7: 4,773,659 S111G probably benign Het
Ist1 A T 8: 109,676,786 I273K probably benign Het
Kdm2b G A 5: 122,881,743 S738L probably benign Het
Lrp2 T A 2: 69,516,551 N784Y probably benign Het
Lrp6 T C 6: 134,485,753 E648G probably damaging Het
Mapk15 G A 15: 75,998,254 E408K probably benign Het
Mdn1 T A 4: 32,718,317 F2191I possibly damaging Het
Metrn C A 17: 25,796,505 V79F possibly damaging Het
Mtbp T A 15: 55,586,493 probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myo3a T A 2: 22,579,741 I508N probably damaging Het
Nat9 A T 11: 115,185,115 Y27N probably damaging Het
Ncapg2 T C 12: 116,429,835 F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 L53Q probably damaging Het
Nlrp3 A T 11: 59,558,448 H852L probably benign Het
Olfr1251 T A 2: 89,667,084 K267N probably damaging Het
Olfr1484 A G 19: 13,585,876 I191V probably benign Het
Olfr1532-ps1 A G 7: 106,915,019 I274V probably benign Het
Olfr594 A T 7: 103,220,351 D211V probably damaging Het
Olfr594 G A 7: 103,220,377 A220T probably benign Het
Olfr720 T A 14: 14,176,092 probably benign Het
Pax9 A G 12: 56,709,743 T289A probably benign Het
Pcyt2 A T 11: 120,615,869 I53N possibly damaging Het
Pdlim4 C T 11: 54,055,049 V327M probably damaging Het
Pdzph1 T A 17: 58,922,761 probably benign Het
Plekhm2 C T 4: 141,642,393 probably benign Het
Ppt1 T C 4: 122,848,423 probably benign Het
Prdm1 C T 10: 44,441,679 E398K probably damaging Het
Prep T C 10: 45,115,078 V280A probably benign Het
Prkdc T A 16: 15,708,701 probably benign Het
Proser3 G A 7: 30,540,138 R514C probably damaging Het
Ptk7 G A 17: 46,572,762 probably benign Het
Rbm45 T C 2: 76,378,398 Y293H probably damaging Het
Rnf213 A C 11: 119,465,052 E4108A possibly damaging Het
Sdk2 A G 11: 113,856,755 L643P probably damaging Het
Sec24d C A 3: 123,350,876 probably benign Het
Sh2d3c C G 2: 32,753,021 H587D probably damaging Het
Slc1a1 G A 19: 28,901,484 G208S probably benign Het
Slc35b4 A T 6: 34,158,517 Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 L126F probably damaging Het
Slc4a8 T C 15: 100,800,493 M621T possibly damaging Het
Slco1a6 T A 6: 142,157,222 probably benign Het
Sncg C T 14: 34,374,538 V15I probably benign Het
Srgap2 T C 1: 131,355,564 T260A probably damaging Het
Stk10 T A 11: 32,587,305 probably benign Het
Taf5 A G 19: 47,075,862 S415G possibly damaging Het
Tdp1 C T 12: 99,954,958 probably benign Het
Tdp2 T G 13: 24,841,350 probably null Het
Tgfbi T A 13: 56,629,774 I357N probably benign Het
Tmem116 A G 5: 121,495,096 T178A probably damaging Het
Tnrc6a G A 7: 123,170,394 R469H probably benign Het
Top2a A T 11: 99,002,903 L1055* probably null Het
Tox T A 4: 6,842,411 M40L probably benign Het
Trib2 A T 12: 15,809,929 H110Q probably benign Het
Trpa1 A G 1: 14,903,215 I293T possibly damaging Het
Trpv2 A G 11: 62,590,260 Y395C probably damaging Het
Ubn2 T A 6: 38,434,600 probably null Het
Ubr4 C T 4: 139,430,176 T2348M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r33 C A 6: 66,612,526 G15* probably null Het
Vmn1r37 T A 6: 66,731,785 S95T probably benign Het
Vmn2r57 A G 7: 41,400,652 C558R probably damaging Het
Vnn1 T C 10: 23,898,602 probably null Het
Vps13c T C 9: 67,919,262 V1395A probably benign Het
Vwa7 A G 17: 35,019,805 I290V probably benign Het
Wdr93 A G 7: 79,758,473 E234G probably damaging Het
Zfp385b A T 2: 77,415,947 S245R probably benign Het
Zfp942 A T 17: 21,928,338 C437S probably damaging Het
Zfyve9 T A 4: 108,718,705 E393V possibly damaging Het
Other mutations in Slc9b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Slc9b2 APN 3 135336395 missense probably benign 0.17
IGL03091:Slc9b2 APN 3 135329030 missense probably damaging 0.97
IGL03203:Slc9b2 APN 3 135326212 missense probably damaging 1.00
IGL03377:Slc9b2 APN 3 135336358 missense probably damaging 1.00
IGL02988:Slc9b2 UTSW 3 135318418 missense probably benign 0.02
R0382:Slc9b2 UTSW 3 135318422 missense probably damaging 0.99
R0628:Slc9b2 UTSW 3 135323775 splice site probably benign
R1263:Slc9b2 UTSW 3 135336395 missense probably benign 0.17
R1478:Slc9b2 UTSW 3 135326102 missense probably benign 0.45
R1809:Slc9b2 UTSW 3 135317131 missense possibly damaging 0.90
R2060:Slc9b2 UTSW 3 135326266 missense probably damaging 0.99
R2119:Slc9b2 UTSW 3 135328982 splice site probably null
R3196:Slc9b2 UTSW 3 135336529 missense probably benign 0.04
R3805:Slc9b2 UTSW 3 135324588 missense probably damaging 1.00
R4127:Slc9b2 UTSW 3 135329837 missense probably benign 0.00
R4401:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4402:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4622:Slc9b2 UTSW 3 135332518 missense probably damaging 1.00
R6125:Slc9b2 UTSW 3 135330696 splice site probably null
R7081:Slc9b2 UTSW 3 135321937 missense probably benign 0.10
R7166:Slc9b2 UTSW 3 135326178 missense unknown
R7203:Slc9b2 UTSW 3 135330661 missense probably benign 0.04
R7307:Slc9b2 UTSW 3 135318390 missense probably benign 0.03
R7617:Slc9b2 UTSW 3 135336460 missense probably damaging 1.00
R7722:Slc9b2 UTSW 3 135329835 missense probably null 0.20
R7748:Slc9b2 UTSW 3 135326179 missense possibly damaging 0.90
R7750:Slc9b2 UTSW 3 135326237 missense probably damaging 1.00
R8339:Slc9b2 UTSW 3 135324602 missense possibly damaging 0.62
R8703:Slc9b2 UTSW 3 135326163 nonsense probably null
R8711:Slc9b2 UTSW 3 135324590 missense not run
R8810:Slc9b2 UTSW 3 135329769 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aatcaggaagtcacaaattccag -3'
Posted On2013-07-11