Incidental Mutation 'R7510:Madd'
ID 582010
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene Name MAP-kinase activating death domain
Synonyms Rab3 GEP, 9630059K23Rik
MMRRC Submission 045583-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7510 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 90967705-91013404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91008321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 194 (T194A)
Ref Sequence ENSEMBL: ENSMUSP00000107001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066420
AA Change: T194A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
AA Change: T194A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
AA Change: T194A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
AA Change: T194A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
AA Change: T194A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
AA Change: T194A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111369
AA Change: T194A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111370
AA Change: T194A

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
AA Change: T194A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
AA Change: T194A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
AA Change: T194A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111375
AA Change: T194A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
AA Change: T194A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
AA Change: T194A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: T194A

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140600
SMART Domains Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
Blast:DENN 1 28 7e-10 BLAST
low complexity region 39 55 N/A INTRINSIC
dDENN 111 165 9.37e-1 SMART
low complexity region 230 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,829,758 (GRCm39) R320C probably benign Het
Bend4 A G 5: 67,584,727 (GRCm39) F66L unknown Het
Brca2 T C 5: 150,460,156 (GRCm39) V477A possibly damaging Het
Brms1l A T 12: 55,892,107 (GRCm39) K134* probably null Het
Catsper1 A T 19: 5,389,578 (GRCm39) T498S probably benign Het
Ccdc177 C A 12: 80,804,457 (GRCm39) V606L unknown Het
D030056L22Rik G T 19: 18,690,853 (GRCm39) A56S possibly damaging Het
Disp1 T C 1: 182,869,975 (GRCm39) N815S probably damaging Het
Dsc2 C T 18: 20,165,331 (GRCm39) G881R possibly damaging Het
Fancf A G 7: 51,511,953 (GRCm39) V17A probably damaging Het
Fastkd2 T A 1: 63,776,948 (GRCm39) H361Q possibly damaging Het
Furin A G 7: 80,043,333 (GRCm39) S293P probably damaging Het
Ghsr A T 3: 27,426,523 (GRCm39) D193V probably benign Het
Gm14403 T A 2: 177,200,403 (GRCm39) N116K probably benign Het
Gpr31b A G 17: 13,270,557 (GRCm39) L204P probably damaging Het
Hexim1 A G 11: 103,008,067 (GRCm39) E107G probably benign Het
Hspa14 T C 2: 3,499,159 (GRCm39) S212G probably benign Het
Il18r1 T A 1: 40,514,035 (GRCm39) H80Q probably benign Het
Itpr3 A G 17: 27,308,013 (GRCm39) T267A probably damaging Het
Kidins220 T A 12: 25,042,268 (GRCm39) H146Q possibly damaging Het
Larp4 T C 15: 99,891,258 (GRCm39) F228L probably benign Het
Ltbp1 T A 17: 75,659,712 (GRCm39) V1288E probably damaging Het
Mlana G A 19: 29,682,072 (GRCm39) G42S probably benign Het
Mlxipl A G 5: 135,161,972 (GRCm39) E548G possibly damaging Het
Mmab A T 5: 114,573,283 (GRCm39) C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nrf1 C T 6: 30,151,633 (GRCm39) T490I possibly damaging Het
Numbl A G 7: 26,971,412 (GRCm39) probably null Het
Or12e13 T A 2: 87,663,872 (GRCm39) I163K probably damaging Het
Or13c7 A G 4: 43,854,482 (GRCm39) T58A probably benign Het
Or5bw2 C T 7: 6,572,960 (GRCm39) probably benign Het
Or5v1b T A 17: 37,841,480 (GRCm39) I204N probably damaging Het
Or6c3b G T 10: 129,527,789 (GRCm39) N40K probably damaging Het
Or9g8 T A 2: 85,607,153 (GRCm39) V75D probably damaging Het
Papln G A 12: 83,818,947 (GRCm39) D96N probably damaging Het
Pcdhb14 T C 18: 37,582,645 (GRCm39) Y584H probably damaging Het
Pde7b T C 10: 20,288,761 (GRCm39) D310G possibly damaging Het
Plin5 T A 17: 56,420,975 (GRCm39) H230L probably damaging Het
Ppp1r13l A C 7: 19,102,726 (GRCm39) E47A possibly damaging Het
Prdm5 C T 6: 65,904,976 (GRCm39) H536Y probably damaging Het
Prickle2 T C 6: 92,353,451 (GRCm39) R728G possibly damaging Het
Prkca A T 11: 107,874,820 (GRCm39) V374E possibly damaging Het
Prss3 A T 6: 41,352,044 (GRCm39) L73* probably null Het
Prss51 G A 14: 64,333,489 (GRCm39) D33N probably damaging Het
Rfwd3 A G 8: 112,006,659 (GRCm39) V479A probably damaging Het
Rpl36a-ps1 G A 14: 99,231,666 (GRCm39) T24I probably benign Het
Rps6ka5 T C 12: 100,582,327 (GRCm39) I182V possibly damaging Het
Saa2 T A 7: 46,402,933 (GRCm39) D61E probably damaging Het
Samd3 A T 10: 26,106,006 (GRCm39) I22F probably benign Het
Sap130 C T 18: 31,800,057 (GRCm39) P403L probably damaging Het
Sap130 A G 18: 31,844,268 (GRCm39) T813A probably damaging Het
Scfd2 A G 5: 74,372,988 (GRCm39) F629S probably damaging Het
Sec61a1 A T 6: 88,489,585 (GRCm39) F119I probably benign Het
Serpinb9 T A 13: 33,194,768 (GRCm39) F175I probably damaging Het
Slc12a3 G T 8: 95,092,477 (GRCm39) C966F probably damaging Het
Sptbn4 A G 7: 27,127,693 (GRCm39) V169A probably benign Het
Synj1 A G 16: 90,735,565 (GRCm39) S1463P probably benign Het
Tfec T A 6: 16,835,232 (GRCm39) H182L probably benign Het
Tigd5 T C 15: 75,782,268 (GRCm39) V210A probably benign Het
Tssc4 G A 7: 142,623,718 (GRCm39) E9K possibly damaging Het
Txk C G 5: 72,893,726 (GRCm39) C18S unknown Het
Uaca G A 9: 60,757,487 (GRCm39) probably null Het
Vmn2r1 A C 3: 63,993,922 (GRCm39) K89N probably damaging Het
Zfp160 G A 17: 21,246,655 (GRCm39) E402K probably benign Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91,006,111 (GRCm39) unclassified probably benign
IGL00781:Madd APN 2 90,977,273 (GRCm39) missense probably benign 0.00
IGL00844:Madd APN 2 90,998,213 (GRCm39) missense probably damaging 1.00
IGL00942:Madd APN 2 91,000,923 (GRCm39) missense probably damaging 1.00
IGL01100:Madd APN 2 90,988,385 (GRCm39) missense probably damaging 1.00
IGL01116:Madd APN 2 90,984,888 (GRCm39) splice site probably benign
IGL01694:Madd APN 2 90,988,320 (GRCm39) splice site probably benign
IGL01982:Madd APN 2 91,006,052 (GRCm39) missense probably damaging 1.00
IGL02346:Madd APN 2 90,992,836 (GRCm39) missense probably damaging 0.97
IGL02354:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02361:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02481:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02483:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02948:Madd APN 2 90,973,172 (GRCm39) missense probably benign
IGL03338:Madd APN 2 90,992,507 (GRCm39) missense possibly damaging 0.48
BB005:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
BB015:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0027:Madd UTSW 2 90,982,894 (GRCm39) missense probably damaging 0.97
R0085:Madd UTSW 2 90,993,083 (GRCm39) missense probably benign 0.00
R0577:Madd UTSW 2 90,968,740 (GRCm39) missense possibly damaging 0.88
R0587:Madd UTSW 2 90,977,230 (GRCm39) missense probably damaging 1.00
R1112:Madd UTSW 2 90,973,944 (GRCm39) missense probably damaging 1.00
R1722:Madd UTSW 2 90,997,982 (GRCm39) missense probably benign
R1750:Madd UTSW 2 90,998,236 (GRCm39) missense probably damaging 0.98
R2061:Madd UTSW 2 90,991,831 (GRCm39) intron probably benign
R2112:Madd UTSW 2 91,007,321 (GRCm39) missense possibly damaging 0.89
R2114:Madd UTSW 2 90,994,367 (GRCm39) missense probably damaging 1.00
R2140:Madd UTSW 2 90,982,854 (GRCm39) missense possibly damaging 0.80
R2276:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2277:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2279:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2424:Madd UTSW 2 90,996,967 (GRCm39) missense probably damaging 1.00
R2904:Madd UTSW 2 91,006,017 (GRCm39) missense probably damaging 1.00
R3122:Madd UTSW 2 91,006,554 (GRCm39) missense probably damaging 1.00
R3836:Madd UTSW 2 90,984,988 (GRCm39) critical splice donor site probably null
R3979:Madd UTSW 2 91,007,173 (GRCm39) missense possibly damaging 0.81
R4151:Madd UTSW 2 90,973,428 (GRCm39) missense probably benign 0.11
R4233:Madd UTSW 2 91,008,581 (GRCm39) missense probably benign 0.26
R4236:Madd UTSW 2 90,997,373 (GRCm39) missense probably benign 0.00
R4299:Madd UTSW 2 91,000,148 (GRCm39) missense probably damaging 1.00
R4334:Madd UTSW 2 90,970,917 (GRCm39) missense probably benign 0.08
R4413:Madd UTSW 2 90,997,932 (GRCm39) missense probably damaging 1.00
R4595:Madd UTSW 2 90,998,009 (GRCm39) missense possibly damaging 0.80
R4694:Madd UTSW 2 90,990,673 (GRCm39) missense probably damaging 0.99
R5410:Madd UTSW 2 90,984,859 (GRCm39) missense probably damaging 1.00
R5490:Madd UTSW 2 91,000,980 (GRCm39) missense possibly damaging 0.80
R5560:Madd UTSW 2 90,993,890 (GRCm39) missense probably damaging 1.00
R5661:Madd UTSW 2 90,984,778 (GRCm39) critical splice donor site probably null
R5710:Madd UTSW 2 90,984,821 (GRCm39) missense probably damaging 1.00
R5730:Madd UTSW 2 90,988,454 (GRCm39) missense probably damaging 1.00
R5759:Madd UTSW 2 90,992,420 (GRCm39) missense possibly damaging 0.94
R5768:Madd UTSW 2 90,998,174 (GRCm39) missense probably damaging 1.00
R5822:Madd UTSW 2 90,982,878 (GRCm39) missense probably damaging 1.00
R6125:Madd UTSW 2 90,982,797 (GRCm39) critical splice donor site probably null
R6151:Madd UTSW 2 90,995,802 (GRCm39) nonsense probably null
R6229:Madd UTSW 2 90,974,015 (GRCm39) missense probably damaging 0.96
R6230:Madd UTSW 2 90,973,866 (GRCm39) critical splice donor site probably null
R6245:Madd UTSW 2 91,008,449 (GRCm39) missense probably benign 0.27
R6323:Madd UTSW 2 90,991,783 (GRCm39) splice site probably null
R6456:Madd UTSW 2 91,008,536 (GRCm39) missense probably benign
R6473:Madd UTSW 2 90,997,404 (GRCm39) missense probably benign
R6878:Madd UTSW 2 91,000,202 (GRCm39) missense probably damaging 1.00
R7060:Madd UTSW 2 91,007,452 (GRCm39) missense probably damaging 1.00
R7065:Madd UTSW 2 90,985,402 (GRCm39) missense probably benign 0.26
R7073:Madd UTSW 2 90,992,854 (GRCm39) missense probably damaging 1.00
R7124:Madd UTSW 2 90,992,393 (GRCm39) missense possibly damaging 0.94
R7251:Madd UTSW 2 90,992,521 (GRCm39) missense probably benign 0.01
R7605:Madd UTSW 2 91,000,055 (GRCm39) missense possibly damaging 0.90
R7911:Madd UTSW 2 90,997,853 (GRCm39) missense probably null 0.01
R7928:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R7952:Madd UTSW 2 90,992,886 (GRCm39) missense probably damaging 1.00
R8039:Madd UTSW 2 90,997,406 (GRCm39) missense probably benign 0.17
R8047:Madd UTSW 2 91,009,546 (GRCm39) missense probably damaging 1.00
R8048:Madd UTSW 2 90,984,793 (GRCm39) missense probably damaging 0.99
R8070:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R8090:Madd UTSW 2 90,985,968 (GRCm39) missense probably benign 0.01
R8335:Madd UTSW 2 91,000,584 (GRCm39) missense probably damaging 1.00
R8459:Madd UTSW 2 90,992,871 (GRCm39) missense probably benign
R8678:Madd UTSW 2 91,006,610 (GRCm39) missense probably damaging 1.00
R8920:Madd UTSW 2 91,007,168 (GRCm39) missense probably benign 0.04
R9003:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R9102:Madd UTSW 2 90,988,404 (GRCm39) missense probably benign 0.00
R9154:Madd UTSW 2 90,998,162 (GRCm39) missense probably damaging 1.00
R9242:Madd UTSW 2 90,973,949 (GRCm39) missense probably damaging 0.99
R9277:Madd UTSW 2 91,006,055 (GRCm39) missense probably damaging 1.00
R9394:Madd UTSW 2 91,000,199 (GRCm39) missense probably benign
R9490:Madd UTSW 2 91,008,501 (GRCm39) missense probably benign
R9499:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9551:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9553:Madd UTSW 2 91,008,800 (GRCm39) missense probably damaging 1.00
R9599:Madd UTSW 2 91,006,026 (GRCm39) missense probably damaging 1.00
R9695:Madd UTSW 2 90,992,929 (GRCm39) missense probably benign 0.17
R9729:Madd UTSW 2 91,000,544 (GRCm39) missense possibly damaging 0.60
X0067:Madd UTSW 2 90,982,818 (GRCm39) missense probably damaging 1.00
Z1176:Madd UTSW 2 90,989,617 (GRCm39) missense probably damaging 0.96
Z1177:Madd UTSW 2 90,973,176 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAAACAGTCCTAAAGGAGCTGAAG -3'
(R):5'- AGAGTGGCTCAACCTTGCAG -3'

Sequencing Primer
(F):5'- AGCCACCATGTAATTGCTGG -3'
(R):5'- TCAACCTTGCAGCCGCCTAG -3'
Posted On 2019-10-17