Incidental Mutation 'R7510:Scfd2'
ID582017
Institutional Source Beutler Lab
Gene Symbol Scfd2
Ensembl Gene ENSMUSG00000062110
Gene NameSec1 family domain containing 2
SynonymsE430013M20Rik, STXBP1L1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location74204816-74531759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74212327 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 629 (F629S)
Ref Sequence ENSEMBL: ENSMUSP00000072636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072857] [ENSMUST00000113542]
Predicted Effect probably damaging
Transcript: ENSMUST00000072857
AA Change: F629S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072636
Gene: ENSMUSG00000062110
AA Change: F629S

DomainStartEndE-ValueType
Pfam:Sec1 25 668 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113542
SMART Domains Protein: ENSMUSP00000109170
Gene: ENSMUSG00000062110

DomainStartEndE-ValueType
low complexity region 471 479 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Scfd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Scfd2 APN 5 74530934 missense possibly damaging 0.67
IGL01094:Scfd2 APN 5 74531046 missense possibly damaging 0.69
IGL02928:Scfd2 APN 5 74531171 missense probably damaging 1.00
IGL03365:Scfd2 APN 5 74530935 missense possibly damaging 0.67
P0035:Scfd2 UTSW 5 74225319 missense possibly damaging 0.89
R1696:Scfd2 UTSW 5 74530878 missense probably benign
R1857:Scfd2 UTSW 5 74212301 nonsense probably null
R2136:Scfd2 UTSW 5 74206367 missense probably benign 0.01
R2205:Scfd2 UTSW 5 74225367 missense possibly damaging 0.93
R2504:Scfd2 UTSW 5 74531177 missense probably damaging 1.00
R3864:Scfd2 UTSW 5 74397720 missense possibly damaging 0.49
R4439:Scfd2 UTSW 5 74397707 missense possibly damaging 0.69
R4590:Scfd2 UTSW 5 74212256 missense probably benign 0.01
R4703:Scfd2 UTSW 5 74519595 missense probably benign 0.00
R4901:Scfd2 UTSW 5 74519565 missense probably damaging 1.00
R4916:Scfd2 UTSW 5 74462658 missense probably damaging 1.00
R4970:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5112:Scfd2 UTSW 5 74206321 missense probably benign 0.15
R5474:Scfd2 UTSW 5 74531364 missense probably benign 0.24
R5706:Scfd2 UTSW 5 74206398 unclassified probably null
R5766:Scfd2 UTSW 5 74462651 missense probably damaging 1.00
R6769:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6771:Scfd2 UTSW 5 74531456 missense probably benign 0.01
R6961:Scfd2 UTSW 5 74519541 missense possibly damaging 0.86
R6963:Scfd2 UTSW 5 74482209 missense probably damaging 1.00
R7151:Scfd2 UTSW 5 74397665 missense possibly damaging 0.56
R7159:Scfd2 UTSW 5 74531343 missense probably benign 0.01
R7602:Scfd2 UTSW 5 74462610 missense probably benign 0.32
R7678:Scfd2 UTSW 5 74458636 missense probably benign
R8074:Scfd2 UTSW 5 74519596 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATGACTTTGGGACAGTG -3'
(R):5'- GTCCTAGCCAACAGAGTCAC -3'

Sequencing Primer
(F):5'- ACTTTGGGACAGTGGCCAG -3'
(R):5'- AGTCACAAGGCGTCAGC -3'
Posted On2019-10-17