Incidental Mutation 'R7510:Furin'
ID582032
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Namefurin (paired basic amino acid cleaving enzyme)
SynonymsPcsk3, PACE, SPC1, 9130404I01Rik, Fur
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80388585-80405436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80393585 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 293 (S293P)
Ref Sequence ENSEMBL: ENSMUSP00000113370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232]
Predicted Effect probably damaging
Transcript: ENSMUST00000107362
AA Change: S293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530
AA Change: S293P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120753
AA Change: S293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530
AA Change: S293P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122232
AA Change: S293P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530
AA Change: S293P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80392567 missense probably damaging 1.00
IGL00910:Furin APN 7 80390996 missense probably benign
IGL01701:Furin APN 7 80392492 missense probably benign 0.11
IGL01701:Furin APN 7 80390759 missense probably benign 0.00
IGL01921:Furin APN 7 80395954 unclassified probably benign
IGL01981:Furin APN 7 80392899 missense probably damaging 1.00
IGL02035:Furin APN 7 80390987 missense probably benign
IGL02096:Furin APN 7 80393459 missense probably damaging 1.00
IGL02508:Furin APN 7 80392521 missense probably benign 0.01
IGL02611:Furin APN 7 80391778 missense probably benign 0.04
R0359:Furin UTSW 7 80391284 missense probably damaging 1.00
R0481:Furin UTSW 7 80393549 missense probably damaging 1.00
R0554:Furin UTSW 7 80391284 missense probably damaging 1.00
R1346:Furin UTSW 7 80392184 unclassified probably benign
R1347:Furin UTSW 7 80392184 unclassified probably benign
R1373:Furin UTSW 7 80392184 unclassified probably benign
R1553:Furin UTSW 7 80398592 unclassified probably null
R1693:Furin UTSW 7 80392482 missense probably damaging 1.00
R4524:Furin UTSW 7 80398634 unclassified probably null
R4687:Furin UTSW 7 80393447 missense probably benign 0.00
R4869:Furin UTSW 7 80396979 missense probably damaging 1.00
R5249:Furin UTSW 7 80393421 missense probably damaging 1.00
R5498:Furin UTSW 7 80391794 missense probably damaging 1.00
R5708:Furin UTSW 7 80397855 intron probably benign
R6086:Furin UTSW 7 80395431 missense probably damaging 1.00
R6505:Furin UTSW 7 80393617 missense probably damaging 1.00
R6772:Furin UTSW 7 80393492 missense probably damaging 1.00
R6945:Furin UTSW 7 80391090 missense possibly damaging 0.82
R6954:Furin UTSW 7 80396964 missense possibly damaging 0.79
R7396:Furin UTSW 7 80398114 missense probably benign 0.00
R7542:Furin UTSW 7 80393459 missense probably damaging 1.00
R7577:Furin UTSW 7 80396986 missense probably damaging 1.00
R7812:Furin UTSW 7 80395974 missense possibly damaging 0.94
R7995:Furin UTSW 7 80395447 missense probably damaging 1.00
X0050:Furin UTSW 7 80395412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGTGGCCCTGAGGAGAG -3'
(R):5'- GTGGCTCTTAAGAAGTGAACTTGG -3'

Sequencing Primer
(F):5'- GGCAAGACTCACGATCTGCTTC -3'
(R):5'- GCTCTTAAGAAGTGAACTTGGAAGTC -3'
Posted On2019-10-17