Incidental Mutation 'R7510:Tssc4'
ID582033
Institutional Source Beutler Lab
Gene Symbol Tssc4
Ensembl Gene ENSMUSG00000045752
Gene Nametumor-suppressing subchromosomal transferable fragment 4
SynonymsESTM671070
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143069249-143071093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143069981 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 9 (E9K)
Ref Sequence ENSEMBL: ENSMUSP00000056582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000037941] [ENSMUST00000060433] [ENSMUST00000105920] [ENSMUST00000133410] [ENSMUST00000137856] [ENSMUST00000141954] [ENSMUST00000147995] [ENSMUST00000150867] [ENSMUST00000177841] [ENSMUST00000207448] [ENSMUST00000208779]
Predicted Effect probably benign
Transcript: ENSMUST00000009390
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037941
SMART Domains Protein: ENSMUSP00000043768
Gene: ENSMUSG00000037706

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 230 9.1e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000060433
AA Change: E9K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056582
Gene: ENSMUSG00000045752
AA Change: E9K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 91 207 3.9e-43 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105920
AA Change: E9K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101540
Gene: ENSMUSG00000045752
AA Change: E9K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133410
AA Change: E78K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123499
Gene: ENSMUSG00000045752
AA Change: E78K

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:TSSC4 159 266 5.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136602
Predicted Effect possibly damaging
Transcript: ENSMUST00000137856
AA Change: E9K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123353
Gene: ENSMUSG00000045752
AA Change: E9K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 209 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141954
Predicted Effect possibly damaging
Transcript: ENSMUST00000147995
AA Change: E9K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122335
Gene: ENSMUSG00000045752
AA Change: E9K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 196 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148715
Predicted Effect probably benign
Transcript: ENSMUST00000150867
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177841
AA Change: E9K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137399
Gene: ENSMUSG00000045752
AA Change: E9K

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
Pfam:TSSC4 90 210 1.7e-34 PFAM
low complexity region 232 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207448
Predicted Effect possibly damaging
Transcript: ENSMUST00000208779
AA Change: E9K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is located among several imprinted genes; however, this gene, as well as the pan-hematopoietic expression gene (PHEMX), escapes imprinting. This gene may play a role in malignancies and disease that involve this region. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Tssc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Tssc4 APN 7 143070201 missense probably benign 0.41
R0582:Tssc4 UTSW 7 143070509 missense probably damaging 0.97
R0655:Tssc4 UTSW 7 143070045 missense probably damaging 0.99
R1447:Tssc4 UTSW 7 143070155 missense probably benign 0.08
R1889:Tssc4 UTSW 7 143070555 missense probably damaging 1.00
R4677:Tssc4 UTSW 7 143070509 missense probably damaging 1.00
R4903:Tssc4 UTSW 7 143070585 missense probably damaging 0.99
R5144:Tssc4 UTSW 7 143070033 missense probably damaging 0.99
R7152:Tssc4 UTSW 7 143070402 missense probably damaging 1.00
R7198:Tssc4 UTSW 7 143070987 utr 3 prime probably null
R7417:Tssc4 UTSW 7 143070688 missense possibly damaging 0.91
R7468:Tssc4 UTSW 7 143069262 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTAACCACCCAGCTTCGCG -3'
(R):5'- AAGGTAGAACTCATGCCTCG -3'

Sequencing Primer
(F):5'- CAGCTTCGCGAGGCCTC -3'
(R):5'- TAGAACTCATGCCTCGGAGGTG -3'
Posted On2019-10-17