Incidental Mutation 'R7510:Slc12a3'
ID582034
Institutional Source Beutler Lab
Gene Symbol Slc12a3
Ensembl Gene ENSMUSG00000031766
Gene Namesolute carrier family 12, member 3
SynonymsNCC, TSC
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94329201-94366214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94365849 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 966 (C966F)
Ref Sequence ENSEMBL: ENSMUSP00000034218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034218]
Predicted Effect probably damaging
Transcript: ENSMUST00000034218
AA Change: C966F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034218
Gene: ENSMUSG00000031766
AA Change: C966F

DomainStartEndE-ValueType
Pfam:AA_permease_N 43 114 1.5e-30 PFAM
Pfam:AA_permease 139 645 3.6e-145 PFAM
Pfam:SLC12 653 801 1.4e-53 PFAM
Pfam:SLC12 787 1001 2e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a renal thiazide-sensitive sodium-chloride cotransporter that is important for electrolyte homeostasis. This cotransporter mediates sodium and chloride reabsorption in the distal convoluted tubule. Mutations in this gene cause Gitelman syndrome, a disease similar to Bartter's syndrome, that is characterized by hypokalemic alkalosis combined with hypomagnesemia, low urinary calcium, and increased renin activity associated with normal blood pressure. This cotransporter is the target for thiazide diuretics that are used for treating high blood pressure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomagnesemia, hypocalciurua and abnormal renal distal convoluted tubule morphology, and show significantly reduced arterial blood pressure on a sodium-depleted diet. Mutant kidney cortical collecting ductsdisplay thiazide-sensitive NaCl absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Slc12a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Slc12a3 APN 8 94357096 missense probably benign 0.00
IGL01947:Slc12a3 APN 8 94365819 critical splice acceptor site probably null
IGL02151:Slc12a3 APN 8 94348592 missense probably benign 0.26
IGL02440:Slc12a3 APN 8 94331682 missense probably damaging 1.00
IGL03213:Slc12a3 APN 8 94335305 missense possibly damaging 0.95
IGL03260:Slc12a3 APN 8 94333242 missense probably damaging 1.00
IGL03306:Slc12a3 APN 8 94351758 missense possibly damaging 0.72
IGL03329:Slc12a3 APN 8 94365891 missense possibly damaging 0.67
avaricious UTSW 8 94330472 missense probably benign 0.01
Pugilist UTSW 8 94345773 critical splice acceptor site probably null
R0131:Slc12a3 UTSW 8 94340883 splice site probably benign
R0189:Slc12a3 UTSW 8 94356358 missense probably benign 0.30
R0330:Slc12a3 UTSW 8 94346346 missense possibly damaging 0.75
R0569:Slc12a3 UTSW 8 94330525 critical splice donor site probably null
R0715:Slc12a3 UTSW 8 94329433 missense possibly damaging 0.75
R1248:Slc12a3 UTSW 8 94333277 missense probably damaging 1.00
R1565:Slc12a3 UTSW 8 94345877 missense possibly damaging 0.75
R2068:Slc12a3 UTSW 8 94345828 missense probably damaging 1.00
R2108:Slc12a3 UTSW 8 94340530 missense probably damaging 0.97
R2273:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2274:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2275:Slc12a3 UTSW 8 94333287 missense possibly damaging 0.86
R2433:Slc12a3 UTSW 8 94346316 missense probably benign 0.00
R3770:Slc12a3 UTSW 8 94353040 missense probably benign
R4429:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4431:Slc12a3 UTSW 8 94343085 missense probably damaging 1.00
R4533:Slc12a3 UTSW 8 94357086 missense probably null 0.02
R4627:Slc12a3 UTSW 8 94329384 missense probably benign
R4856:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4886:Slc12a3 UTSW 8 94351810 critical splice donor site probably null
R4908:Slc12a3 UTSW 8 94348588 missense possibly damaging 0.76
R5054:Slc12a3 UTSW 8 94346351 missense probably damaging 1.00
R5299:Slc12a3 UTSW 8 94351789 missense probably damaging 1.00
R5451:Slc12a3 UTSW 8 94357027 missense possibly damaging 0.61
R5590:Slc12a3 UTSW 8 94345788 missense probably damaging 1.00
R5725:Slc12a3 UTSW 8 94330446 missense probably benign 0.00
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6038:Slc12a3 UTSW 8 94330472 missense probably benign 0.01
R6162:Slc12a3 UTSW 8 94345773 critical splice acceptor site probably null
R6266:Slc12a3 UTSW 8 94358471 missense possibly damaging 0.93
R6489:Slc12a3 UTSW 8 94335004 missense possibly damaging 0.96
R6521:Slc12a3 UTSW 8 94343113 missense possibly damaging 0.84
R6882:Slc12a3 UTSW 8 94365918 missense possibly damaging 0.51
R7051:Slc12a3 UTSW 8 94365944 missense probably damaging 1.00
R7805:Slc12a3 UTSW 8 94344887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCAGGGAGGTCTTAC -3'
(R):5'- CGCTGATGGATGGGATGATAC -3'

Sequencing Primer
(F):5'- CAGGGAGGTCTTACGGTGAG -3'
(R):5'- AGTAGAACTTGAAGCCTCTTCTCCAG -3'
Posted On2019-10-17