Incidental Mutation 'R7510:Atp2b1'
ID582039
Institutional Source Beutler Lab
Gene Symbol Atp2b1
Ensembl Gene ENSMUSG00000019943
Gene NameATPase, Ca++ transporting, plasma membrane 1
SynonymsPMCA1, 2810442I22Rik, E130111D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location98914406-99026143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98993896 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 320 (R320C)
Ref Sequence ENSEMBL: ENSMUSP00000020107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020107] [ENSMUST00000219624]
Predicted Effect probably benign
Transcript: ENSMUST00000020107
AA Change: R320C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943
AA Change: R320C

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.8e-3 SMART
low complexity region 138 156 N/A INTRINSIC
Pfam:E1-E2_ATPase 157 312 1.5e-28 PFAM
Pfam:E1-E2_ATPase 348 464 1.4e-13 PFAM
Pfam:HAD 472 806 6.9e-22 PFAM
Pfam:Cation_ATPase 492 614 8.8e-17 PFAM
Pfam:Hydrolase 605 809 5.8e-14 PFAM
Pfam:Hydrolase_3 764 842 7.2e-7 PFAM
transmembrane domain 855 877 N/A INTRINSIC
Pfam:Cation_ATPase_C 879 1061 1.2e-47 PFAM
low complexity region 1079 1092 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1103 1155 7.5e-31 PFAM
low complexity region 1176 1188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219624
AA Change: R320C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Atp2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Atp2b1 APN 10 99015020 missense possibly damaging 0.84
IGL00972:Atp2b1 APN 10 99015044 missense probably damaging 1.00
IGL00977:Atp2b1 APN 10 98986975 missense possibly damaging 0.88
IGL01154:Atp2b1 APN 10 98996888 missense probably damaging 1.00
IGL03073:Atp2b1 APN 10 98999851 missense probably damaging 1.00
IGL03081:Atp2b1 APN 10 98994813 splice site probably benign
PIT4453001:Atp2b1 UTSW 10 99016978 missense probably benign 0.00
R0157:Atp2b1 UTSW 10 98999947 missense probably damaging 0.99
R0200:Atp2b1 UTSW 10 98979814 nonsense probably null
R0899:Atp2b1 UTSW 10 99017031 critical splice donor site probably null
R0981:Atp2b1 UTSW 10 99015629 missense probably damaging 1.00
R1163:Atp2b1 UTSW 10 98979851 missense possibly damaging 0.91
R1569:Atp2b1 UTSW 10 98987326 missense probably benign 0.02
R1572:Atp2b1 UTSW 10 98994675 missense probably benign 0.10
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1721:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1782:Atp2b1 UTSW 10 99003201 missense probably benign 0.01
R1840:Atp2b1 UTSW 10 99022929 missense probably benign 0.00
R1867:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1868:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1944:Atp2b1 UTSW 10 99022931 missense probably damaging 0.97
R1984:Atp2b1 UTSW 10 99014492 missense possibly damaging 0.95
R2055:Atp2b1 UTSW 10 99014559 missense probably damaging 1.00
R2325:Atp2b1 UTSW 10 99018895 nonsense probably null
R2399:Atp2b1 UTSW 10 98999923 missense probably benign 0.02
R2876:Atp2b1 UTSW 10 98999745 missense probably damaging 0.96
R3762:Atp2b1 UTSW 10 99009489 missense probably damaging 1.00
R3776:Atp2b1 UTSW 10 98979869 frame shift probably null
R3808:Atp2b1 UTSW 10 99003148 missense possibly damaging 0.74
R3978:Atp2b1 UTSW 10 98996933 unclassified probably null
R4391:Atp2b1 UTSW 10 99003214 missense probably benign 0.00
R4825:Atp2b1 UTSW 10 99009564 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 99003170 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 98994809 critical splice donor site probably null
R6018:Atp2b1 UTSW 10 99010760 missense probably damaging 1.00
R6179:Atp2b1 UTSW 10 99022829 missense probably damaging 1.00
R6455:Atp2b1 UTSW 10 99016980 missense possibly damaging 0.76
R6496:Atp2b1 UTSW 10 99003337 missense probably damaging 0.98
R6786:Atp2b1 UTSW 10 99016959 missense probably damaging 1.00
R6814:Atp2b1 UTSW 10 99023015 missense possibly damaging 0.87
R7034:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7036:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7079:Atp2b1 UTSW 10 99018733 missense probably benign 0.01
R7216:Atp2b1 UTSW 10 98986977 missense probably benign 0.30
R7562:Atp2b1 UTSW 10 99022805 splice site probably null
R7651:Atp2b1 UTSW 10 99016968 missense probably damaging 0.99
R7739:Atp2b1 UTSW 10 99001365 missense probably benign 0.01
R8005:Atp2b1 UTSW 10 98994799 missense probably damaging 1.00
Z1177:Atp2b1 UTSW 10 99018848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTTGTAGGACCTAGGAAGTG -3'
(R):5'- GGCAGCACAGATCGTAATTAAC -3'

Sequencing Primer
(F):5'- TGGACGGGGTCAGCAAGC -3'
(R):5'- AGATCGTAATTAACACTCTCTTCTGC -3'
Posted On2019-10-17