Incidental Mutation 'R7510:Brms1l'
ID582044
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Namebreast cancer metastasis-suppressor 1-like
SynonymsD12Ertd407e, BRMS1, 0710008O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55836324-55869736 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55845322 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 134 (K134*)
Ref Sequence ENSEMBL: ENSMUSP00000082500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
Predicted Effect probably null
Transcript: ENSMUST00000059250
AA Change: K134*
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: K134*

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000219419
AA Change: K134*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55845326 missense probably benign 0.15
IGL00951:Brms1l APN 12 55866049 missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55861172 critical splice donor site probably benign
IGL02669:Brms1l APN 12 55841616 missense probably damaging 1.00
IGL03158:Brms1l APN 12 55836535 missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55868277 makesense probably null
R0445:Brms1l UTSW 12 55861406 nonsense probably null
R0568:Brms1l UTSW 12 55861388 critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55865957 missense probably benign 0.00
R0968:Brms1l UTSW 12 55866013 missense possibly damaging 0.73
R1240:Brms1l UTSW 12 55844508 missense probably damaging 1.00
R1580:Brms1l UTSW 12 55868222 missense probably damaging 1.00
R1694:Brms1l UTSW 12 55841600 missense probably damaging 1.00
R1926:Brms1l UTSW 12 55863161 missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55863173 missense probably benign 0.01
R4669:Brms1l UTSW 12 55841571 missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55866015 missense probably benign 0.15
R6010:Brms1l UTSW 12 55868200 missense possibly damaging 0.55
R6129:Brms1l UTSW 12 55868185 missense probably benign 0.03
R7429:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7430:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7543:Brms1l UTSW 12 55868212 missense probably damaging 1.00
R7855:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
R7938:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCATGGTTTCTTAGCTCATGAACTC -3'
(R):5'- TTCCAGTACAGCAACCAGTAG -3'

Sequencing Primer
(F):5'- GCAGACTGTAGGGAAGTT -3'
(R):5'- TTCCAGTACAGCAACCAGTAGAACTG -3'
Posted On2019-10-17