Mutagenetix > Incidental Mutations

Incidental Mutation 'R7510:Olfr111'

582057

Institutional Source

Beutler Lab

Gene Symbol

Olfr111

Ensembl Gene

ENSMUSG00000090675

Gene Name

olfactory receptor 111

Synonyms

MOR249-1P, GA_x6K02T2PSCP-1989071-1990024

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.665) question?

Stock #

R7510 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37508030-37532449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37530589 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 204 (I204N)

Ref Sequence

ENSEMBL: ENSMUSP00000150585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097325] [ENSMUST00000214259] [ENSMUST00000215424]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097325
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094933
Gene: ENSMUSG00000090675
AA Change: I204N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	5.4e-54	PFAM
Pfam:7TM_GPCR_Srsx	35	302	1.5e-5	PFAM
Pfam:7tm_1	41	290	1.4e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214259
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000215424
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp2b1	C	T	10: 98,993,896	R320C	probably benign	Het
Bend4	A	G	5: 67,427,384	F66L	unknown	Het
Brca2	T	C	5: 150,536,691	V477A	possibly damaging	Het
Brms1l	A	T	12: 55,845,322	K134*	probably null	Het
Catsper1	A	T	19: 5,339,550	T498S	probably benign	Het
Ccdc177	C	A	12: 80,757,683	V606L	unknown	Het
D030056L22Rik	G	T	19: 18,713,489	A56S	possibly damaging	Het
Disp1	T	C	1: 183,088,411	N815S	probably damaging	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Fancf	A	G	7: 51,862,205	V17A	probably damaging	Het
Fastkd2	T	A	1: 63,737,789	H361Q	possibly damaging	Het
Furin	A	G	7: 80,393,585	S293P	probably damaging	Het
Ghsr	A	T	3: 27,372,374	D193V	probably benign	Het
Gm14403	T	A	2: 177,508,610	N116K	probably benign	Het
Gpr31b	A	G	17: 13,051,670	L204P	probably damaging	Het
Hexim1	A	G	11: 103,117,241	E107G	probably benign	Het
Hspa14	T	C	2: 3,498,122	S212G	probably benign	Het
Il18r1	T	A	1: 40,474,875	H80Q	probably benign	Het
Itpr3	A	G	17: 27,089,039	T267A	probably damaging	Het
Kidins220	T	A	12: 24,992,269	H146Q	possibly damaging	Het
Larp4	T	C	15: 99,993,377	F228L	probably benign	Het
Ltbp1	T	A	17: 75,352,717	V1288E	probably damaging	Het
Madd	T	C	2: 91,177,976	T194A	possibly damaging	Het
Mlana	G	A	19: 29,704,672	G42S	probably benign	Het
Mlxipl	A	G	5: 135,133,118	E548G	possibly damaging	Het
Mmab	A	T	5: 114,435,222	C228S	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Nrf1	C	T	6: 30,151,634	T490I	possibly damaging	Het
Numbl	A	G	7: 27,271,987		probably null	Het
Olfr1014	T	A	2: 85,776,809	V75D	probably damaging	Het
Olfr1148	T	A	2: 87,833,528	I163K	probably damaging	Het
Olfr1350	C	T	7: 6,569,961		probably benign	Het
Olfr155	A	G	4: 43,854,482	T58A	probably benign	Het
Olfr803	G	T	10: 129,691,920	N40K	probably damaging	Het
Papln	G	A	12: 83,772,173	D96N	probably damaging	Het
Pcdhb14	T	C	18: 37,449,592	Y584H	probably damaging	Het
Pde7b	T	C	10: 20,413,015	D310G	possibly damaging	Het
Plin5	T	A	17: 56,113,975	H230L	probably damaging	Het
Ppp1r13l	A	C	7: 19,368,801	E47A	possibly damaging	Het
Prdm5	C	T	6: 65,927,992	H536Y	probably damaging	Het
Prickle2	T	C	6: 92,376,470	R728G	possibly damaging	Het
Prkca	A	T	11: 107,983,994	V374E	possibly damaging	Het
Prss3	A	T	6: 41,375,110	L73*	probably null	Het
Prss51	G	A	14: 64,096,040	D33N	probably damaging	Het
Rfwd3	A	G	8: 111,280,027	V479A	probably damaging	Het
Rpl36a-ps1	G	A	14: 98,994,230	T24I	probably benign	Het
Rps6ka5	T	C	12: 100,616,068	I182V	possibly damaging	Het
Saa2	T	A	7: 46,753,509	D61E	probably damaging	Het
Samd3	A	T	10: 26,230,108	I22F	probably benign	Het
Sap130	C	T	18: 31,667,004	P403L	probably damaging	Het
Sap130	A	G	18: 31,711,215	T813A	probably damaging	Het
Scfd2	A	G	5: 74,212,327	F629S	probably damaging	Het
Sec61a1	A	T	6: 88,512,603	F119I	probably benign	Het
Serpinb9	T	A	13: 33,010,785	F175I	probably damaging	Het
Slc12a3	G	T	8: 94,365,849	C966F	probably damaging	Het
Sptbn4	A	G	7: 27,428,268	V169A	probably benign	Het
Synj1	A	G	16: 90,938,677	S1463P	probably benign	Het
Tfec	T	A	6: 16,835,233	H182L	probably benign	Het
Tigd5	T	C	15: 75,910,419	V210A	probably benign	Het
Tssc4	G	A	7: 143,069,981	E9K	possibly damaging	Het
Txk	C	G	5: 72,736,383	C18S	unknown	Het
Uaca	G	A	9: 60,850,205		probably null	Het
Vmn2r1	A	C	3: 64,086,501	K89N	probably damaging	Het
Zfp160	G	A	17: 21,026,393	E402K	probably benign	Het

Other mutations in Olfr111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01870:Olfr111	APN	17	37530664	missense	probably benign	0.00
IGL02472:Olfr111	APN	17	37530749	missense	probably damaging	1.00
IGL02511:Olfr111	APN	17	37529979	start codon destroyed	probably null	0.99
R0335:Olfr111	UTSW	17	37530642	missense	probably benign	0.01
R2006:Olfr111	UTSW	17	37530706	missense	probably damaging	1.00
R3757:Olfr111	UTSW	17	37530355	missense	probably damaging	1.00
R4167:Olfr111	UTSW	17	37530006	missense	possibly damaging	0.65
R4904:Olfr111	UTSW	17	37530631	missense	probably damaging	1.00
R4952:Olfr111	UTSW	17	37530750	missense	possibly damaging	0.48
R7366:Olfr111	UTSW	17	37530817	missense	probably damaging	0.99
R7389:Olfr111	UTSW	17	37530657	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- TATTATGAACAAGGCCCTGTGCAG -3'
(R):5'- CGAGTAAGATGAGATGGGCCTC -3'

Sequencing Primer
(F):5'- TGGTTAGCAGCCTCATGC -3'
(R):5'- TGAGATGGGCCTCACATACGTG -3'

Posted On

2019-10-17