Incidental Mutation 'R7510:Olfr111'
ID582057
Institutional Source Beutler Lab
Gene Symbol Olfr111
Ensembl Gene ENSMUSG00000090675
Gene Nameolfactory receptor 111
SynonymsMOR249-1P, GA_x6K02T2PSCP-1989071-1990024
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37508030-37532449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37530589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 204 (I204N)
Ref Sequence ENSEMBL: ENSMUSP00000150585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097325] [ENSMUST00000214259] [ENSMUST00000215424]
Predicted Effect probably damaging
Transcript: ENSMUST00000097325
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094933
Gene: ENSMUSG00000090675
AA Change: I204N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 302 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214259
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215424
AA Change: I204N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Olfr111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Olfr111 APN 17 37530664 missense probably benign 0.00
IGL02472:Olfr111 APN 17 37530749 missense probably damaging 1.00
IGL02511:Olfr111 APN 17 37529979 start codon destroyed probably null 0.99
R0335:Olfr111 UTSW 17 37530642 missense probably benign 0.01
R2006:Olfr111 UTSW 17 37530706 missense probably damaging 1.00
R3757:Olfr111 UTSW 17 37530355 missense probably damaging 1.00
R4167:Olfr111 UTSW 17 37530006 missense possibly damaging 0.65
R4904:Olfr111 UTSW 17 37530631 missense probably damaging 1.00
R4952:Olfr111 UTSW 17 37530750 missense possibly damaging 0.48
R7366:Olfr111 UTSW 17 37530817 missense probably damaging 0.99
R7389:Olfr111 UTSW 17 37530657 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TATTATGAACAAGGCCCTGTGCAG -3'
(R):5'- CGAGTAAGATGAGATGGGCCTC -3'

Sequencing Primer
(F):5'- TGGTTAGCAGCCTCATGC -3'
(R):5'- TGAGATGGGCCTCACATACGTG -3'
Posted On2019-10-17