Incidental Mutation 'R7510:Plin5'
ID582058
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Nameperilipin 5
SynonymsMLDP, Lsdp5, 2310076L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56111601-56117596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56113975 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 230 (H230L)
Ref Sequence ENSEMBL: ENSMUSP00000019808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000019808] [ENSMUST00000113072] [ENSMUST00000190703]
Predicted Effect probably benign
Transcript: ENSMUST00000002908
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019808
AA Change: H230L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: H230L

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113072
AA Change: H230L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: H230L

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190703
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Meta Mutation Damage Score 0.3335 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Plin5 UTSW 17 56115597 missense probably damaging 1.00
R0981:Plin5 UTSW 17 56114020 missense probably damaging 1.00
R1966:Plin5 UTSW 17 56112186 missense probably damaging 1.00
R2153:Plin5 UTSW 17 56116836 missense probably benign 0.02
R2368:Plin5 UTSW 17 56115588 missense probably damaging 1.00
R4809:Plin5 UTSW 17 56116855 missense probably benign 0.00
R5173:Plin5 UTSW 17 56115548 splice site probably null
R5315:Plin5 UTSW 17 56114066 missense probably benign 0.15
R5836:Plin5 UTSW 17 56115549 critical splice donor site probably null
R7129:Plin5 UTSW 17 56115174 missense probably null
R8305:Plin5 UTSW 17 56115221 missense probably benign 0.00
X0028:Plin5 UTSW 17 56116324 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTCTGGGAGCCCAATCTC -3'
(R):5'- TACTCTGGAATGATGAGTGGC -3'

Sequencing Primer
(F):5'- GAGCCCAATCTCCAGCAAGAG -3'
(R):5'- TACTCTGGAATGATGAGTGGCAGAAG -3'
Posted On2019-10-17