Incidental Mutation 'R7510:Sap130'
ID582062
Institutional Source Beutler Lab
Gene Symbol Sap130
Ensembl Gene ENSMUSG00000024260
Gene NameSin3A associated protein
Synonyms2610304F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location31634371-31723061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31711215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 813 (T813A)
Ref Sequence ENSEMBL: ENSMUSP00000025109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025109] [ENSMUST00000178164]
Predicted Effect probably damaging
Transcript: ENSMUST00000025109
AA Change: T813A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025109
Gene: ENSMUSG00000024260
AA Change: T813A

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
low complexity region 716 748 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 894 904 N/A INTRINSIC
low complexity region 1044 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178164
AA Change: T814A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136842
Gene: ENSMUSG00000024260
AA Change: T814A

DomainStartEndE-ValueType
low complexity region 82 107 N/A INTRINSIC
low complexity region 115 124 N/A INTRINSIC
low complexity region 347 356 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
Pfam:SAP130_C 635 1040 5.4e-224 PFAM
low complexity region 1045 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAP130 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a transposon insertion are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pcdhb14 T C 18: 37,449,592 Y584H probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Sap130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Sap130 APN 18 31698766 missense probably benign 0.00
IGL01060:Sap130 APN 18 31715443 missense probably damaging 1.00
IGL01668:Sap130 APN 18 31680440 missense probably damaging 0.97
IGL01797:Sap130 APN 18 31698668 missense probably damaging 0.98
IGL01872:Sap130 APN 18 31674420 missense probably damaging 0.98
IGL02010:Sap130 APN 18 31649602 missense probably damaging 0.98
PIT4142001:Sap130 UTSW 18 31667011 critical splice donor site probably null
PIT4366001:Sap130 UTSW 18 31677409 missense probably benign 0.06
R0083:Sap130 UTSW 18 31666329 splice site probably benign
R0083:Sap130 UTSW 18 31711641 missense probably damaging 1.00
R0243:Sap130 UTSW 18 31680681 splice site probably benign
R0255:Sap130 UTSW 18 31680506 missense probably damaging 1.00
R0704:Sap130 UTSW 18 31653554 missense probably damaging 0.99
R1069:Sap130 UTSW 18 31711629 missense probably damaging 0.96
R1086:Sap130 UTSW 18 31650620 splice site probably benign
R1162:Sap130 UTSW 18 31648173 missense probably damaging 1.00
R1478:Sap130 UTSW 18 31680474 missense possibly damaging 0.95
R1484:Sap130 UTSW 18 31711327 missense probably damaging 1.00
R1554:Sap130 UTSW 18 31666472 missense probably damaging 0.99
R1625:Sap130 UTSW 18 31674464 missense probably damaging 0.99
R1771:Sap130 UTSW 18 31636082 missense probably benign 0.10
R1793:Sap130 UTSW 18 31698587 missense probably benign 0.10
R1905:Sap130 UTSW 18 31680567 missense possibly damaging 0.67
R2026:Sap130 UTSW 18 31698574 missense possibly damaging 0.81
R2074:Sap130 UTSW 18 31648279 missense probably damaging 0.99
R2174:Sap130 UTSW 18 31677479 critical splice donor site probably null
R3927:Sap130 UTSW 18 31674382 missense possibly damaging 0.95
R4454:Sap130 UTSW 18 31711360 missense probably damaging 1.00
R4980:Sap130 UTSW 18 31649646 missense possibly damaging 0.95
R5222:Sap130 UTSW 18 31666703 missense probably damaging 1.00
R5345:Sap130 UTSW 18 31648198 missense probably benign 0.32
R5811:Sap130 UTSW 18 31689442 missense probably benign 0.01
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6034:Sap130 UTSW 18 31689406 missense possibly damaging 0.92
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6038:Sap130 UTSW 18 31680486 missense probably damaging 0.99
R6129:Sap130 UTSW 18 31682091 missense possibly damaging 0.94
R6431:Sap130 UTSW 18 31666365 missense possibly damaging 0.95
R6930:Sap130 UTSW 18 31682088 missense possibly damaging 0.94
R6932:Sap130 UTSW 18 31666354 missense possibly damaging 0.88
R7454:Sap130 UTSW 18 31650512 missense probably benign 0.01
R7510:Sap130 UTSW 18 31667004 missense probably damaging 1.00
R7641:Sap130 UTSW 18 31653623 missense probably damaging 0.99
R7870:Sap130 UTSW 18 31720661 missense probably benign 0.15
R7953:Sap130 UTSW 18 31720661 missense probably benign 0.15
X0021:Sap130 UTSW 18 31647076 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCACAGTGCCTGCCTCAATTAG -3'
(R):5'- ACTCTTTGGGAGGAGACTTGC -3'

Sequencing Primer
(F):5'- CAGTGCCTGCCTCAATTAGAATATG -3'
(R):5'- AGGAGACTTGCGCTTCTCAG -3'
Posted On2019-10-17