Incidental Mutation 'R7510:Pcdhb14'
ID582063
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Nameprotocadherin beta 14
SynonymsPcdhbN, 2210006M07Rik, Pcdhb17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7510 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37447656-37456350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37449592 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 584 (Y584H)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000052387
AA Change: Y584H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: Y584H

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp2b1 C T 10: 98,993,896 R320C probably benign Het
Bend4 A G 5: 67,427,384 F66L unknown Het
Brca2 T C 5: 150,536,691 V477A possibly damaging Het
Brms1l A T 12: 55,845,322 K134* probably null Het
Catsper1 A T 19: 5,339,550 T498S probably benign Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
D030056L22Rik G T 19: 18,713,489 A56S possibly damaging Het
Disp1 T C 1: 183,088,411 N815S probably damaging Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Fancf A G 7: 51,862,205 V17A probably damaging Het
Fastkd2 T A 1: 63,737,789 H361Q possibly damaging Het
Furin A G 7: 80,393,585 S293P probably damaging Het
Ghsr A T 3: 27,372,374 D193V probably benign Het
Gm14403 T A 2: 177,508,610 N116K probably benign Het
Gpr31b A G 17: 13,051,670 L204P probably damaging Het
Hexim1 A G 11: 103,117,241 E107G probably benign Het
Hspa14 T C 2: 3,498,122 S212G probably benign Het
Il18r1 T A 1: 40,474,875 H80Q probably benign Het
Itpr3 A G 17: 27,089,039 T267A probably damaging Het
Kidins220 T A 12: 24,992,269 H146Q possibly damaging Het
Larp4 T C 15: 99,993,377 F228L probably benign Het
Ltbp1 T A 17: 75,352,717 V1288E probably damaging Het
Madd T C 2: 91,177,976 T194A possibly damaging Het
Mlana G A 19: 29,704,672 G42S probably benign Het
Mlxipl A G 5: 135,133,118 E548G possibly damaging Het
Mmab A T 5: 114,435,222 C228S probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nrf1 C T 6: 30,151,634 T490I possibly damaging Het
Numbl A G 7: 27,271,987 probably null Het
Olfr1014 T A 2: 85,776,809 V75D probably damaging Het
Olfr111 T A 17: 37,530,589 I204N probably damaging Het
Olfr1148 T A 2: 87,833,528 I163K probably damaging Het
Olfr1350 C T 7: 6,569,961 probably benign Het
Olfr155 A G 4: 43,854,482 T58A probably benign Het
Olfr803 G T 10: 129,691,920 N40K probably damaging Het
Papln G A 12: 83,772,173 D96N probably damaging Het
Pde7b T C 10: 20,413,015 D310G possibly damaging Het
Plin5 T A 17: 56,113,975 H230L probably damaging Het
Ppp1r13l A C 7: 19,368,801 E47A possibly damaging Het
Prdm5 C T 6: 65,927,992 H536Y probably damaging Het
Prickle2 T C 6: 92,376,470 R728G possibly damaging Het
Prkca A T 11: 107,983,994 V374E possibly damaging Het
Prss3 A T 6: 41,375,110 L73* probably null Het
Prss51 G A 14: 64,096,040 D33N probably damaging Het
Rfwd3 A G 8: 111,280,027 V479A probably damaging Het
Rpl36a-ps1 G A 14: 98,994,230 T24I probably benign Het
Rps6ka5 T C 12: 100,616,068 I182V possibly damaging Het
Saa2 T A 7: 46,753,509 D61E probably damaging Het
Samd3 A T 10: 26,230,108 I22F probably benign Het
Sap130 C T 18: 31,667,004 P403L probably damaging Het
Sap130 A G 18: 31,711,215 T813A probably damaging Het
Scfd2 A G 5: 74,212,327 F629S probably damaging Het
Sec61a1 A T 6: 88,512,603 F119I probably benign Het
Serpinb9 T A 13: 33,010,785 F175I probably damaging Het
Slc12a3 G T 8: 94,365,849 C966F probably damaging Het
Sptbn4 A G 7: 27,428,268 V169A probably benign Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Tfec T A 6: 16,835,233 H182L probably benign Het
Tigd5 T C 15: 75,910,419 V210A probably benign Het
Tssc4 G A 7: 143,069,981 E9K possibly damaging Het
Txk C G 5: 72,736,383 C18S unknown Het
Uaca G A 9: 60,850,205 probably null Het
Vmn2r1 A C 3: 64,086,501 K89N probably damaging Het
Zfp160 G A 17: 21,026,393 E402K probably benign Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37450033 missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37450195 missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37449770 missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37448018 nonsense probably null
IGL02797:Pcdhb14 APN 18 37449851 missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37449032 missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37449004 missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37448489 unclassified probably null
R0467:Pcdhb14 UTSW 18 37449224 missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37448339 missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37448868 missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37448587 missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37449592 missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37449890 missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37449594 nonsense probably null
R1743:Pcdhb14 UTSW 18 37448178 missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37449482 missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37449535 missense probably benign
R2131:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37447870 missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37449662 missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37448545 missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37448305 missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37450142 missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37448847 missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37448278 missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37450170 missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37448806 missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37448996 missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37448750 missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37448242 missense probably benign
R6090:Pcdhb14 UTSW 18 37448606 missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37449230 missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37448444 missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37449692 missense probably damaging 1.00
R7394:Pcdhb14 UTSW 18 37448908 missense probably benign 0.29
R7724:Pcdhb14 UTSW 18 37448884 missense possibly damaging 0.62
R7757:Pcdhb14 UTSW 18 37449834 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449421 missense possibly damaging 0.95
X0065:Pcdhb14 UTSW 18 37449984 nonsense probably null
Z1177:Pcdhb14 UTSW 18 37449854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAATGGGCAGCTGTTTG -3'
(R):5'- TTGTCCTTGACCAGCAGGAG -3'

Sequencing Primer
(F):5'- TCAGGGCGCTGGACTATGAG -3'
(R):5'- TTGACCAGCAGGAGCAGCC -3'
Posted On2019-10-17