Incidental Mutation 'R7511:Igfbp2'
ID582068
Institutional Source Beutler Lab
Gene Symbol Igfbp2
Ensembl Gene ENSMUSG00000039323
Gene Nameinsulin-like growth factor binding protein 2
SynonymsIGFBP-2, Igfbp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7511 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location72824503-72852474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72852005 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 254 (M254R)
Ref Sequence ENSEMBL: ENSMUSP00000046610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047328] [ENSMUST00000120564]
Predicted Effect probably damaging
Transcript: ENSMUST00000047328
AA Change: M254R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046610
Gene: ENSMUSG00000039323
AA Change: M254R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 38 117 2.08e-35 SMART
TY 238 290 1.17e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120564
AA Change: M107R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112706
Gene: ENSMUSG00000039323
AA Change: M107R

DomainStartEndE-ValueType
TY 91 143 1.17e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several similar proteins that bind insulin-like growth factors I and II (Igf-I and Igf-II). The encoded protein can be secreted into the bloodstream, where it binds Igf-I and Igf-II with high affinity, or it can remain intracellular, interacting with many different ligands. Two transcript variants, one encoding a secreted isoform and the other encoding a nonsecreted isoform, have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in reduced spleen, heart and kidney size and increased liver weight. Homozygotes for another allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Igfbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igfbp2 APN 1 72849128 missense probably benign 0.02
IGL02435:Igfbp2 APN 1 72852086 missense probably damaging 1.00
R1138:Igfbp2 UTSW 1 72849098 missense probably damaging 0.99
R1688:Igfbp2 UTSW 1 72824966 critical splice donor site probably null
R2045:Igfbp2 UTSW 1 72852151 missense probably benign 0.13
R5704:Igfbp2 UTSW 1 72852144 missense probably benign 0.02
R6128:Igfbp2 UTSW 1 72824799 missense probably damaging 1.00
R6395:Igfbp2 UTSW 1 72824919 missense probably damaging 1.00
R6836:Igfbp2 UTSW 1 72849658 missense probably damaging 1.00
R7002:Igfbp2 UTSW 1 72849645 missense probably damaging 0.99
R7586:Igfbp2 UTSW 1 72849148 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCCAGGCAGAAGTTTAGTG -3'
(R):5'- TCAAAACTGGGAACTCCTCC -3'

Sequencing Primer
(F):5'- GCAGAAGTTTAGTGCCACCTGTC -3'
(R):5'- AAGCCAGGCACCGACTG -3'
Posted On2019-10-17