Incidental Mutation 'R7511:Pi4kb'
ID582077
Institutional Source Beutler Lab
Gene Symbol Pi4kb
Ensembl Gene ENSMUSG00000038861
Gene Namephosphatidylinositol 4-kinase beta
SynonymsESTM41, Pik4cb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7511 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94974731-95006843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94989312 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 307 (S307P)
Ref Sequence ENSEMBL: ENSMUSP00000102872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000138209] [ENSMUST00000167008]
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
AA Change: S307P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861
AA Change: S307P

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
AA Change: S319P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861
AA Change: S319P

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138209
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Pi4kb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Pi4kb APN 3 95004263 missense probably damaging 1.00
IGL01559:Pi4kb APN 3 94984129 missense probably benign 0.00
IGL03003:Pi4kb APN 3 94984812 missense probably benign 0.00
IGL03087:Pi4kb APN 3 94984764 missense probably benign
R0014:Pi4kb UTSW 3 94998897 missense probably damaging 1.00
R0196:Pi4kb UTSW 3 94998950 missense probably damaging 1.00
R0387:Pi4kb UTSW 3 94984740 missense probably benign 0.42
R0394:Pi4kb UTSW 3 94996804 intron probably benign
R0394:Pi4kb UTSW 3 94996805 intron probably benign
R1485:Pi4kb UTSW 3 94994387 missense probably damaging 0.99
R3700:Pi4kb UTSW 3 94994288 missense probably benign 0.09
R4449:Pi4kb UTSW 3 94984735 missense probably benign 0.41
R4502:Pi4kb UTSW 3 94996607 missense probably benign 0.02
R4717:Pi4kb UTSW 3 94998851 missense probably damaging 1.00
R4737:Pi4kb UTSW 3 95004338 missense probably damaging 1.00
R4763:Pi4kb UTSW 3 95004409 intron probably benign
R5322:Pi4kb UTSW 3 94994249 missense probably benign 0.04
R5427:Pi4kb UTSW 3 94994207 missense probably benign 0.09
R5622:Pi4kb UTSW 3 94998861 missense possibly damaging 0.56
R5625:Pi4kb UTSW 3 94984677 missense probably benign 0.15
R5755:Pi4kb UTSW 3 94994297 unclassified probably null
R5926:Pi4kb UTSW 3 94998996 missense probably damaging 1.00
R6904:Pi4kb UTSW 3 94993150 missense probably damaging 1.00
R6984:Pi4kb UTSW 3 94996934 missense probably damaging 1.00
R7221:Pi4kb UTSW 3 94994189 missense probably damaging 1.00
R7312:Pi4kb UTSW 3 94984577 missense probably benign 0.12
R7571:Pi4kb UTSW 3 94999114 critical splice donor site probably null
R7885:Pi4kb UTSW 3 94999076 missense probably damaging 1.00
R7968:Pi4kb UTSW 3 94999076 missense probably damaging 1.00
Z1088:Pi4kb UTSW 3 94984509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCAGTTTCAGGCTG -3'
(R):5'- CGTCTGTGAGCAAAGGATCAG -3'

Sequencing Primer
(F):5'- GGCTGACTGTCTTTCACTAAAGCAG -3'
(R):5'- TGTCAGGGCACTAAAGCTC -3'
Posted On2019-10-17