Incidental Mutation 'R7511:Vgf'
ID582087
Institutional Source Beutler Lab
Gene Symbol Vgf
Ensembl Gene ENSMUSG00000037428
Gene NameVGF nerve growth factor inducible
SynonymsLOC381677
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7511 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location137026392-137033351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 137031391 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 136 (P136T)
Ref Sequence ENSEMBL: ENSMUSP00000048273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000186451] [ENSMUST00000187382] [ENSMUST00000190827]
Predicted Effect unknown
Transcript: ENSMUST00000041543
AA Change: P136T
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428
AA Change: P136T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186451
AA Change: P136T
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428
AA Change: P136T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187382
AA Change: P136T
SMART Domains Protein: ENSMUSP00000140093
Gene: ENSMUSG00000037428
AA Change: P136T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190827
AA Change: P136T
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428
AA Change: P136T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small, lean, hyperactive, hypermetabolic, and infertile. Mutants exhibit markedly reduced leptin levels and altered hypothalamic proopiomelanocortin, neuropeptide Y, and agouti-related peptide expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Vgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Vgf UTSW 5 137031482 unclassified probably benign
R1832:Vgf UTSW 5 137031299 missense possibly damaging 0.46
R1960:Vgf UTSW 5 137032175 unclassified probably benign
R2256:Vgf UTSW 5 137031547 unclassified probably benign
R3433:Vgf UTSW 5 137031019 missense probably benign 0.27
R4751:Vgf UTSW 5 137032401 missense probably damaging 0.99
R5304:Vgf UTSW 5 137032286 missense probably damaging 0.96
R6874:Vgf UTSW 5 137031532 unclassified probably benign
R6944:Vgf UTSW 5 137032352 missense probably damaging 0.99
R6969:Vgf UTSW 5 137031653 unclassified probably benign
R7499:Vgf UTSW 5 137032245 missense probably damaging 0.99
R7791:Vgf UTSW 5 137032031 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCTGAGCATAATGGGCAG -3'
(R):5'- TCTCCAGATTGACTCGGGTC -3'

Sequencing Primer
(F):5'- TCAGGACCAGGGAGAGCTCTTC -3'
(R):5'- ACTCGGGTCAGCGTGTG -3'
Posted On2019-10-17