Mutagenetix > Incidental Mutations

Incidental Mutation 'R7511:Cacna1a'

582098

Institutional Source

Beutler Lab

Gene Symbol

Cacna1a

Ensembl Gene

ENSMUSG00000034656

Gene Name

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

Synonyms

Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R7511 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84388440-84640246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84567682 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1158 (E1158G)

Ref Sequence

ENSEMBL: ENSMUSP00000112436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121390
AA Change: E1158G

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: E1158G

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122053
AA Change: E1111G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: E1111G

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215756
AA Change: E1110G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,882,954	K327E	probably damaging	Het
Adamts14	G	A	10: 61,218,528	A572V	possibly damaging	Het
Add2	A	G	6: 86,098,615	N249D	probably benign	Het
Adgrb2	A	T	4: 130,022,111	M1503L	probably benign	Het
Alms1	A	G	6: 85,609,425	K421E	unknown	Het
B3galt5	A	G	16: 96,315,716	K183R	possibly damaging	Het
Braf	T	C	6: 39,688,253	I94M	probably damaging	Het
Ccdc177	C	A	12: 80,757,683	V606L	unknown	Het
Ccdc38	C	A	10: 93,562,800	L147I	possibly damaging	Het
Ccdc83	T	C	7: 90,236,922	N210D	possibly damaging	Het
Cdh7	T	C	1: 109,997,853		probably benign	Het
Coro1b	T	A	19: 4,152,526	Y338N	probably damaging	Het
Crlf3	A	C	11: 80,063,986		probably null	Het
Crnn	A	T	3: 93,149,416	K503M	probably damaging	Het
Cul5	T	A	9: 53,625,969	N521I	probably damaging	Het
Cyp2c50	T	A	19: 40,092,190		probably null	Het
Dis3	T	C	14: 99,099,606	H23R	possibly damaging	Het
Dock7	A	T	4: 99,061,282	L441H		Het
Dock7	C	A	4: 99,079,755	E162*	probably null	Het
Dpp9	A	T	17: 56,205,611	M174K	possibly damaging	Het
Dtd1	A	G	2: 144,617,227	D57G	probably benign	Het
F3	A	G	3: 121,731,557	E149G	probably damaging	Het
Glp2r	C	T	11: 67,757,591	R95K	probably damaging	Het
Gm13103	T	A	4: 143,846,546	I3N	possibly damaging	Het
Gm38394	T	A	1: 133,659,243	I119L	probably benign	Het
Gpr107	T	A	2: 31,178,346	F273L	probably benign	Het
Gria1	A	T	11: 57,283,625	I647F	probably damaging	Het
Heatr5a	A	C	12: 51,879,434	I1878S	possibly damaging	Het
Hsf2	G	T	10: 57,504,557	C230F	probably benign	Het
Igfbp2	T	G	1: 72,852,005	M254R	probably damaging	Het
Kifc2	C	A	15: 76,661,337	Q95K	possibly damaging	Het
Lnx1	T	G	5: 74,620,311	N183T	probably benign	Het
Ltn1	G	T	16: 87,408,828	T983K	possibly damaging	Het
Macf1	A	T	4: 123,473,300	V2556D	possibly damaging	Het
Map4k3	A	G	17: 80,597,648	V738A	possibly damaging	Het
Mtmr12	T	G	15: 12,265,595	Y466D	possibly damaging	Het
Musk	A	G	4: 58,333,672	I256V	probably benign	Het
Ociad1	T	C	5: 73,294,995	F43S	probably damaging	Het
Olfr729	A	G	14: 50,148,256	L206P	probably damaging	Het
Olfr980	A	T	9: 40,006,933	S5R	possibly damaging	Het
Pah	G	A	10: 87,554,387	A132T	probably damaging	Het
Pak7	G	A	2: 136,083,324	S686F	possibly damaging	Het
Pi4kb	T	C	3: 94,989,312	S307P	probably benign	Het
Plxna1	T	C	6: 89,341,907	T645A	possibly damaging	Het
Pold1	C	T	7: 44,542,190	R124K	possibly damaging	Het
Prdm10	T	C	9: 31,378,481	Y1153H	probably damaging	Het
Ptk2b	T	C	14: 66,154,244	N947S	possibly damaging	Het
Rad54b	A	G	4: 11,578,956		probably null	Het
S1pr4	A	G	10: 81,499,789		probably benign	Het
Sec23b	A	G	2: 144,590,349	K760E	probably benign	Het
Sergef	T	A	7: 46,614,746	N239I	probably damaging	Het
Serpinb9	C	A	13: 33,008,071	N78K	probably benign	Het
Sntb1	G	T	15: 55,647,951	F412L	possibly damaging	Het
Stradb	T	A	1: 58,992,949	F294L	probably damaging	Het
Ttll11	G	A	2: 35,903,034	R266C	probably damaging	Het
Ttn	A	T	2: 76,794,538	M15232K	possibly damaging	Het
Tubgcp2	T	C	7: 140,004,880	I547M	probably benign	Het
Vgf	C	A	5: 137,031,391	P136T	unknown	Het
Vmn1r36	T	A	6: 66,716,930		probably benign	Het
Vmn2r102	T	C	17: 19,681,143	S511P	probably damaging	Het
Wdr27	C	T	17: 14,883,703	V714I	probably benign	Het
Zfp229	A	G	17: 21,745,064	S92G	probably benign	Het
Zfp710	C	T	7: 80,082,502	Q476*	probably null	Het
Zfp808	A	G	13: 62,172,823	N622S	probably benign	Het

Other mutations in Cacna1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Cacna1a	APN	8	84571208	nonsense	probably null
IGL00513:Cacna1a	APN	8	84553056	missense	probably damaging	1.00
IGL00569:Cacna1a	APN	8	84462714	missense	probably damaging	1.00
IGL00981:Cacna1a	APN	8	84548553	missense	probably damaging	1.00
IGL01122:Cacna1a	APN	8	84614793	critical splice donor site	probably null
IGL01309:Cacna1a	APN	8	84523028	missense	probably damaging	1.00
IGL01380:Cacna1a	APN	8	84559117	missense	probably damaging	1.00
IGL01638:Cacna1a	APN	8	84571827	missense	probably damaging	0.98
IGL01682:Cacna1a	APN	8	84536438	missense	possibly damaging	0.71
IGL02751:Cacna1a	APN	8	84569952	missense	probably damaging	1.00
IGL02904:Cacna1a	APN	8	84579520	missense	probably damaging	1.00
IGL03122:Cacna1a	APN	8	84462676	splice site	probably benign
totter	UTSW	8	84588753	missense	probably damaging	0.99
totter2	UTSW	8	84588753	missense	probably damaging	0.99
FR4340:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638714	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4548:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638726	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638726	small insertion	probably benign
IGL03134:Cacna1a	UTSW	8	84559087	missense	probably damaging	1.00
R0055:Cacna1a	UTSW	8	84580058	splice site	probably benign
R0118:Cacna1a	UTSW	8	84536083	missense	probably damaging	1.00
R0284:Cacna1a	UTSW	8	84612285	missense	probably damaging	1.00
R0581:Cacna1a	UTSW	8	84601936	missense	possibly damaging	0.83
R0607:Cacna1a	UTSW	8	84629831	missense	probably damaging	1.00
R1168:Cacna1a	UTSW	8	84579501	missense	probably damaging	1.00
R1183:Cacna1a	UTSW	8	84580217	missense	probably damaging	1.00
R1470:Cacna1a	UTSW	8	84514950	splice site	probably benign
R1503:Cacna1a	UTSW	8	84601946	missense	probably benign	0.23
R1522:Cacna1a	UTSW	8	84633433	missense	probably benign	0.00
R1835:Cacna1a	UTSW	8	84581357	splice site	probably null
R1862:Cacna1a	UTSW	8	84415930	missense	possibly damaging	0.80
R2148:Cacna1a	UTSW	8	84629675	missense	possibly damaging	0.71
R2237:Cacna1a	UTSW	8	84633765	critical splice donor site	probably null
R2567:Cacna1a	UTSW	8	84549725	missense	probably damaging	1.00
R2999:Cacna1a	UTSW	8	84567742	missense	probably damaging	1.00
R3025:Cacna1a	UTSW	8	84580225	critical splice donor site	probably null
R3610:Cacna1a	UTSW	8	84559065	missense	probably damaging	1.00
R3702:Cacna1a	UTSW	8	84617846	missense	probably damaging	0.98
R3763:Cacna1a	UTSW	8	84583642	missense	possibly damaging	0.85
R4025:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4026:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4106:Cacna1a	UTSW	8	84583695	missense	possibly damaging	0.85
R4296:Cacna1a	UTSW	8	84559293	missense	probably damaging	1.00
R4664:Cacna1a	UTSW	8	84601767	nonsense	probably null
R4713:Cacna1a	UTSW	8	84549514	missense	probably damaging	1.00
R5223:Cacna1a	UTSW	8	84587195	missense	possibly damaging	0.94
R5408:Cacna1a	UTSW	8	84549707	missense	probably damaging	1.00
R5644:Cacna1a	UTSW	8	84462777	missense	probably damaging	1.00
R5734:Cacna1a	UTSW	8	84583731	missense	probably damaging	0.96
R5786:Cacna1a	UTSW	8	84415721	unclassified	probably benign
R5833:Cacna1a	UTSW	8	84518697	missense	probably damaging	1.00
R5886:Cacna1a	UTSW	8	84523022	missense	probably damaging	0.99
R6049:Cacna1a	UTSW	8	84638846	missense	probably damaging	0.96
R6054:Cacna1a	UTSW	8	84556785	missense	probably damaging	0.99
R6117:Cacna1a	UTSW	8	84614721	missense	probably damaging	1.00
R6149:Cacna1a	UTSW	8	84569952	missense	probably damaging	1.00
R6195:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6233:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6607:Cacna1a	UTSW	8	84579492	missense	probably damaging	1.00
R6753:Cacna1a	UTSW	8	84580205	missense	probably damaging	1.00
R6798:Cacna1a	UTSW	8	84611602	missense	probably damaging	1.00
R6831:Cacna1a	UTSW	8	84571231	missense	probably damaging	1.00
R6980:Cacna1a	UTSW	8	84612285	missense	possibly damaging	0.85
R7051:Cacna1a	UTSW	8	84629915	missense	possibly damaging	0.85
R7270:Cacna1a	UTSW	8	84571237	missense	probably damaging	1.00
R7409:Cacna1a	UTSW	8	84533402	missense	probably damaging	1.00
R7491:Cacna1a	UTSW	8	84559293	missense	possibly damaging	0.92
R7745:Cacna1a	UTSW	8	84559394	missense	probably benign	0.01
R7872:Cacna1a	UTSW	8	84583654	missense	probably damaging	1.00
R7899:Cacna1a	UTSW	8	84594173	missense	possibly damaging	0.72
R7986:Cacna1a	UTSW	8	84638779	missense	probably benign	0.02
R8126:Cacna1a	UTSW	8	84633252	missense	probably benign	0.02
R8266:Cacna1a	UTSW	8	84559219	missense	probably damaging	1.00
R8458:Cacna1a	UTSW	8	84549458	missense	probably damaging	1.00
R8504:Cacna1a	UTSW	8	84638741	missense	probably benign
RF029:Cacna1a	UTSW	8	84638724	small insertion	probably benign
X0022:Cacna1a	UTSW	8	84633699	missense	possibly damaging	0.53
Z1176:Cacna1a	UTSW	8	84415676	missense	unknown
Z1177:Cacna1a	UTSW	8	84579491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGGCATACAAGAAGC -3'
(R):5'- GCAGAGGAGTTACACCCTAC -3'

Sequencing Primer
(F):5'- GCCTGGCATACAAGAAGCTTTTTC -3'
(R):5'- AGGAGCGCTACACCCTG -3'

Posted On

2019-10-17