Incidental Mutation 'R7511:Dis3'
ID582113
Institutional Source Beutler Lab
Gene Symbol Dis3
Ensembl Gene ENSMUSG00000033166
Gene NameDIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms2810028N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7511 (G1)
Quality Score113.008
Status Validated
Chromosome14
Chromosomal Location99075206-99099770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99099606 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 23 (H23R)
Ref Sequence ENSEMBL: ENSMUSP00000041906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650] [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]
Predicted Effect probably benign
Transcript: ENSMUST00000022650
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042471
AA Change: H23R

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: H23R

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227022
AA Change: H23R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228643
AA Change: H23R

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Wdr27 C T 17: 14,883,703 V714I probably benign Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Dis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dis3 APN 14 99082674 missense probably damaging 1.00
IGL00821:Dis3 APN 14 99091486 missense probably benign 0.00
IGL00975:Dis3 APN 14 99079234 missense probably damaging 1.00
IGL01536:Dis3 APN 14 99079423 missense probably damaging 1.00
IGL01538:Dis3 APN 14 99097745 missense probably benign 0.00
IGL02143:Dis3 APN 14 99091318 splice site probably benign
IGL02270:Dis3 APN 14 99078354 missense probably benign 0.01
IGL02354:Dis3 APN 14 99079712 nonsense probably null
IGL02361:Dis3 APN 14 99079712 nonsense probably null
IGL02650:Dis3 APN 14 99098785 missense probably benign 0.00
IGL03053:Dis3 APN 14 99098734 missense probably benign 0.00
IGL03057:Dis3 APN 14 99089990 missense possibly damaging 0.95
IGL03389:Dis3 APN 14 99095347 splice site probably benign
R0415:Dis3 UTSW 14 99087456 missense probably damaging 1.00
R0504:Dis3 UTSW 14 99081390 splice site probably benign
R1535:Dis3 UTSW 14 99079426 missense probably damaging 1.00
R1756:Dis3 UTSW 14 99086103 missense probably damaging 1.00
R1767:Dis3 UTSW 14 99084142 missense probably damaging 1.00
R1883:Dis3 UTSW 14 99091469 missense probably benign 0.21
R1938:Dis3 UTSW 14 99097590 missense probably benign 0.09
R2056:Dis3 UTSW 14 99098815 missense possibly damaging 0.90
R2133:Dis3 UTSW 14 99079877 missense probably benign 0.18
R2448:Dis3 UTSW 14 99087412 missense probably damaging 0.99
R3407:Dis3 UTSW 14 99098776 missense probably benign 0.15
R4052:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4207:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4208:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4465:Dis3 UTSW 14 99084114 missense possibly damaging 0.88
R4612:Dis3 UTSW 14 99091435 missense probably benign 0.07
R4859:Dis3 UTSW 14 99087790 missense probably damaging 1.00
R4932:Dis3 UTSW 14 99088904 missense probably damaging 1.00
R5273:Dis3 UTSW 14 99098806 missense probably benign 0.32
R5335:Dis3 UTSW 14 99097653 missense possibly damaging 0.72
R5409:Dis3 UTSW 14 99085932 missense possibly damaging 0.95
R5802:Dis3 UTSW 14 99099664 missense probably damaging 1.00
R6156:Dis3 UTSW 14 99098779 missense probably benign 0.10
R6309:Dis3 UTSW 14 99085922 missense probably benign 0.00
R7275:Dis3 UTSW 14 99087489 missense probably damaging 1.00
R7535:Dis3 UTSW 14 99089979 missense probably benign 0.15
R7794:Dis3 UTSW 14 99098797 missense probably benign 0.04
R8013:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8014:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8077:Dis3 UTSW 14 99090035 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATCAGGGAACGGTACCTC -3'
(R):5'- TGTAGTCCAGAGGAAAGCCC -3'

Sequencing Primer
(F):5'- AACGGTACCTCAGCCTGGATG -3'
(R):5'- AATCACCGCGACCGTCG -3'
Posted On2019-10-17