Incidental Mutation 'R7511:Wdr27'
ID582119
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7511 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14883703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 714 (V714I)
Ref Sequence ENSEMBL: ENSMUSP00000126736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably benign
Transcript: ENSMUST00000170386
AA Change: V714I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: V714I

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228330
AA Change: V714I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232147
AA Change: V714I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,954 K327E probably damaging Het
Adamts14 G A 10: 61,218,528 A572V possibly damaging Het
Add2 A G 6: 86,098,615 N249D probably benign Het
Adgrb2 A T 4: 130,022,111 M1503L probably benign Het
Alms1 A G 6: 85,609,425 K421E unknown Het
B3galt5 A G 16: 96,315,716 K183R possibly damaging Het
Braf T C 6: 39,688,253 I94M probably damaging Het
Cacna1a A G 8: 84,567,682 E1158G possibly damaging Het
Ccdc177 C A 12: 80,757,683 V606L unknown Het
Ccdc38 C A 10: 93,562,800 L147I possibly damaging Het
Ccdc83 T C 7: 90,236,922 N210D possibly damaging Het
Cdh7 T C 1: 109,997,853 probably benign Het
Coro1b T A 19: 4,152,526 Y338N probably damaging Het
Crlf3 A C 11: 80,063,986 probably null Het
Crnn A T 3: 93,149,416 K503M probably damaging Het
Cul5 T A 9: 53,625,969 N521I probably damaging Het
Cyp2c50 T A 19: 40,092,190 probably null Het
Dis3 T C 14: 99,099,606 H23R possibly damaging Het
Dock7 A T 4: 99,061,282 L441H Het
Dock7 C A 4: 99,079,755 E162* probably null Het
Dpp9 A T 17: 56,205,611 M174K possibly damaging Het
Dtd1 A G 2: 144,617,227 D57G probably benign Het
F3 A G 3: 121,731,557 E149G probably damaging Het
Glp2r C T 11: 67,757,591 R95K probably damaging Het
Gm13103 T A 4: 143,846,546 I3N possibly damaging Het
Gm38394 T A 1: 133,659,243 I119L probably benign Het
Gpr107 T A 2: 31,178,346 F273L probably benign Het
Gria1 A T 11: 57,283,625 I647F probably damaging Het
Heatr5a A C 12: 51,879,434 I1878S possibly damaging Het
Hsf2 G T 10: 57,504,557 C230F probably benign Het
Igfbp2 T G 1: 72,852,005 M254R probably damaging Het
Kifc2 C A 15: 76,661,337 Q95K possibly damaging Het
Lnx1 T G 5: 74,620,311 N183T probably benign Het
Ltn1 G T 16: 87,408,828 T983K possibly damaging Het
Macf1 A T 4: 123,473,300 V2556D possibly damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mtmr12 T G 15: 12,265,595 Y466D possibly damaging Het
Musk A G 4: 58,333,672 I256V probably benign Het
Ociad1 T C 5: 73,294,995 F43S probably damaging Het
Olfr729 A G 14: 50,148,256 L206P probably damaging Het
Olfr980 A T 9: 40,006,933 S5R possibly damaging Het
Pah G A 10: 87,554,387 A132T probably damaging Het
Pak7 G A 2: 136,083,324 S686F possibly damaging Het
Pi4kb T C 3: 94,989,312 S307P probably benign Het
Plxna1 T C 6: 89,341,907 T645A possibly damaging Het
Pold1 C T 7: 44,542,190 R124K possibly damaging Het
Prdm10 T C 9: 31,378,481 Y1153H probably damaging Het
Ptk2b T C 14: 66,154,244 N947S possibly damaging Het
Rad54b A G 4: 11,578,956 probably null Het
S1pr4 A G 10: 81,499,789 probably benign Het
Sec23b A G 2: 144,590,349 K760E probably benign Het
Sergef T A 7: 46,614,746 N239I probably damaging Het
Serpinb9 C A 13: 33,008,071 N78K probably benign Het
Sntb1 G T 15: 55,647,951 F412L possibly damaging Het
Stradb T A 1: 58,992,949 F294L probably damaging Het
Ttll11 G A 2: 35,903,034 R266C probably damaging Het
Ttn A T 2: 76,794,538 M15232K possibly damaging Het
Tubgcp2 T C 7: 140,004,880 I547M probably benign Het
Vgf C A 5: 137,031,391 P136T unknown Het
Vmn1r36 T A 6: 66,716,930 probably benign Het
Vmn2r102 T C 17: 19,681,143 S511P probably damaging Het
Zfp229 A G 17: 21,745,064 S92G probably benign Het
Zfp710 C T 7: 80,082,502 Q476* probably null Het
Zfp808 A G 13: 62,172,823 N622S probably benign Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTCTCTGTAACAAGGGTCAG -3'
(R):5'- CCAGTATTGTTAGGTGTCAGTAGTC -3'

Sequencing Primer
(F):5'- TAACAAGGGTCAGGTTGCATCCC -3'
(R):5'- CCTGAGGAAGATGTGAGTCTGATCC -3'
Posted On2019-10-17