Incidental Mutation 'R7512:Col19a1'
ID582126
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7512 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24317707 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 632 (G632R)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect probably damaging
Transcript: ENSMUST00000051344
AA Change: G632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: G632R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115244
AA Change: G632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: G632R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7481:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATGTCCTTACGTCATTCCCTG -3'
(R):5'- GCATGTGCGAGCAAAGTCTC -3'

Sequencing Primer
(F):5'- TGGCATCCCTGGAGTTCCTG -3'
(R):5'- CATACTTCTAGCCTCGGATAGTTGG -3'
Posted On2019-10-17