Incidental Mutation 'R7512:Ccnt2'
ID582127
Institutional Source Beutler Lab
Gene Symbol Ccnt2
Ensembl Gene ENSMUSG00000026349
Gene Namecyclin T2
Synonyms2900041I18Rik, CycT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7512 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location127774164-127808061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127802294 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 303 (S303T)
Ref Sequence ENSEMBL: ENSMUSP00000027587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027587] [ENSMUST00000112570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027587
AA Change: S303T

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027587
Gene: ENSMUSG00000026349
AA Change: S303T

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 653 N/A INTRINSIC
low complexity region 658 664 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112570
AA Change: S303T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108189
Gene: ENSMUSG00000026349
AA Change: S303T

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to the 4-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Ccnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ccnt2 APN 1 127797891 splice site probably benign
IGL01370:Ccnt2 APN 1 127803513 missense possibly damaging 0.49
IGL02055:Ccnt2 APN 1 127791710 missense possibly damaging 0.46
IGL02169:Ccnt2 APN 1 127774389 splice site probably benign
R0526:Ccnt2 UTSW 1 127799445 missense probably damaging 1.00
R0538:Ccnt2 UTSW 1 127803165 missense probably damaging 0.98
R0744:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0833:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0836:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R1763:Ccnt2 UTSW 1 127799406 missense possibly damaging 0.94
R2037:Ccnt2 UTSW 1 127803399 missense probably damaging 1.00
R2159:Ccnt2 UTSW 1 127775154 missense probably benign 0.00
R4585:Ccnt2 UTSW 1 127803029 missense probably damaging 0.99
R5342:Ccnt2 UTSW 1 127791733 splice site silent
R5527:Ccnt2 UTSW 1 127802664 missense probably benign 0.00
R5698:Ccnt2 UTSW 1 127803228 missense probably benign 0.00
R6606:Ccnt2 UTSW 1 127803241 missense probably benign 0.00
R6821:Ccnt2 UTSW 1 127803335 missense probably damaging 0.99
R6979:Ccnt2 UTSW 1 127775136 missense probably damaging 0.97
X0019:Ccnt2 UTSW 1 127775140 missense probably damaging 1.00
X0027:Ccnt2 UTSW 1 127774288 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCATAGAACTTGGAATTCAGG -3'
(R):5'- GTCCTGGCTGAATCTGGATG -3'

Sequencing Primer
(F):5'- GGTAGATTTGTTTCCATGAACTTCC -3'
(R):5'- AATCTGGATGCTGGGGCCAC -3'
Posted On2019-10-17