Incidental Mutation 'R7512:Lrrc41'
ID582134
Institutional Source Beutler Lab
Gene Symbol Lrrc41
Ensembl Gene ENSMUSG00000028703
Gene Nameleucine rich repeat containing 41
SynonymsD730026A16Rik, MUF1, D630045E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R7512 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116075269-116097043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116092994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 535 (T535A)
Ref Sequence ENSEMBL: ENSMUSP00000030471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030471
AA Change: T535A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703
AA Change: T535A

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102704
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102705
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Sort1 T A 3: 108,326,007 probably null Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Lrrc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Lrrc41 APN 4 116096466 missense probably damaging 0.97
IGL01358:Lrrc41 APN 4 116075587 missense probably benign 0.16
IGL01734:Lrrc41 APN 4 116093134 critical splice donor site probably null
IGL01986:Lrrc41 APN 4 116089322 missense probably benign 0.27
IGL02159:Lrrc41 APN 4 116088486 missense probably benign 0.03
IGL02892:Lrrc41 APN 4 116088835 missense possibly damaging 0.68
IGL03135:Lrrc41 APN 4 116088531 missense probably benign
R1478:Lrrc41 UTSW 4 116095208 nonsense probably null
R1765:Lrrc41 UTSW 4 116089051 missense possibly damaging 0.94
R2233:Lrrc41 UTSW 4 116096385 missense possibly damaging 0.66
R4080:Lrrc41 UTSW 4 116080546 splice site probably null
R4677:Lrrc41 UTSW 4 116095135 missense probably benign
R4833:Lrrc41 UTSW 4 116093177 unclassified probably benign
R4877:Lrrc41 UTSW 4 116079405 missense probably damaging 0.99
R4926:Lrrc41 UTSW 4 116089324 missense possibly damaging 0.46
R6459:Lrrc41 UTSW 4 116088780 missense possibly damaging 0.95
R6817:Lrrc41 UTSW 4 116089305 missense possibly damaging 0.66
R6834:Lrrc41 UTSW 4 116096529 missense possibly damaging 0.46
R7479:Lrrc41 UTSW 4 116089041 missense probably damaging 0.96
R7593:Lrrc41 UTSW 4 116092944 missense possibly damaging 0.94
R8006:Lrrc41 UTSW 4 116094888 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATGGAGTTTGCACTGAATATTCTGC -3'
(R):5'- CGCAGATGATGTTCCCTTCATC -3'

Sequencing Primer
(F):5'- GCTTAAATTTCCCACATCTGTAACC -3'
(R):5'- GATGATGTTCCCTTCATCTACCCAC -3'
Posted On2019-10-17