Incidental Mutation 'R7512:Kntc1'
ID582141
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R7512 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123790938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1259 (L1259P)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: L1259P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: L1259P

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7581:Kntc1 UTSW 5 123816755 missense probably benign 0.05
R7687:Kntc1 UTSW 5 123759089 missense probably benign 0.01
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGAATTAGGTCATTCCTGAAAGC -3'
(R):5'- ATTGGTGCCTTTGCCAACAG -3'

Sequencing Primer
(F):5'- TAGAGGGCCTACGTTCAGTTCC -3'
(R):5'- TGCCTTTGCCAACAGGAAAG -3'
Posted On2019-10-17