Incidental Mutation 'R7512:Mtmr14'
ID582147
Institutional Source Beutler Lab
Gene Symbol Mtmr14
Ensembl Gene ENSMUSG00000030269
Gene Namemyotubularin related protein 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7512 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113237843-113281392 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 113268691 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 409 (Q409*)
Ref Sequence ENSEMBL: ENSMUSP00000108771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000134945] [ENSMUST00000142938] [ENSMUST00000203385]
Predicted Effect probably null
Transcript: ENSMUST00000113146
AA Change: Q409*
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269
AA Change: Q409*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129883
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134945
AA Change: Q77*
SMART Domains Protein: ENSMUSP00000118001
Gene: ENSMUSG00000030269
AA Change: Q77*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:C2 221 256 3e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000137772
AA Change: Q122*
SMART Domains Protein: ENSMUSP00000119000
Gene: ENSMUSG00000030269
AA Change: Q122*

DomainStartEndE-ValueType
Pfam:Myotub-related 10 231 5.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142938
SMART Domains Protein: ENSMUSP00000121136
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144976
Predicted Effect probably null
Transcript: ENSMUST00000148523
AA Change: Q87*
SMART Domains Protein: ENSMUSP00000115808
Gene: ENSMUSG00000030269
AA Change: Q87*

DomainStartEndE-ValueType
Pfam:Myotub-related 1 102 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151149
Predicted Effect probably benign
Transcript: ENSMUST00000203385
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination, decreased exercise endurance, increased muscle fatigue, and muscle atrophy associated with impaired muscular calcium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Sort1 T A 3: 108,326,007 probably null Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Mtmr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Mtmr14 APN 6 113266326 missense probably damaging 0.98
IGL01686:Mtmr14 APN 6 113240430 missense possibly damaging 0.58
IGL02508:Mtmr14 APN 6 113240306 missense probably damaging 1.00
R0147:Mtmr14 UTSW 6 113260666 splice site probably benign
R0394:Mtmr14 UTSW 6 113280688 nonsense probably null
R0529:Mtmr14 UTSW 6 113266252 unclassified probably benign
R0675:Mtmr14 UTSW 6 113270647 missense probably damaging 0.99
R0723:Mtmr14 UTSW 6 113270512 unclassified probably benign
R0785:Mtmr14 UTSW 6 113277947 critical splice donor site probably null
R0866:Mtmr14 UTSW 6 113239582 critical splice donor site probably null
R1721:Mtmr14 UTSW 6 113253732 missense probably damaging 1.00
R1998:Mtmr14 UTSW 6 113277924 missense probably null
R2063:Mtmr14 UTSW 6 113240361 missense probably damaging 1.00
R2192:Mtmr14 UTSW 6 113280739 missense probably damaging 1.00
R2656:Mtmr14 UTSW 6 113240366 missense probably benign 0.03
R4648:Mtmr14 UTSW 6 113260606 missense probably benign 0.12
R5209:Mtmr14 UTSW 6 113253775 nonsense probably null
R5509:Mtmr14 UTSW 6 113253807 critical splice donor site probably null
R5569:Mtmr14 UTSW 6 113240285 missense probably damaging 0.96
R5589:Mtmr14 UTSW 6 113261282 critical splice donor site probably null
R5924:Mtmr14 UTSW 6 113253789 missense probably damaging 1.00
R5997:Mtmr14 UTSW 6 113280614 missense probably damaging 0.97
R6182:Mtmr14 UTSW 6 113269508 missense possibly damaging 0.78
R6658:Mtmr14 UTSW 6 113265476 nonsense probably null
R6752:Mtmr14 UTSW 6 113240397 missense probably damaging 1.00
R7325:Mtmr14 UTSW 6 113269548 missense probably damaging 0.98
R7816:Mtmr14 UTSW 6 113266302 missense probably damaging 1.00
X0023:Mtmr14 UTSW 6 113261255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGCAGGGTTCACAAAGAAG -3'
(R):5'- ACAAGGAACGGCAAGTCCTC -3'

Sequencing Primer
(F):5'- GGGTTCACAAAGAAGGTCATTCCC -3'
(R):5'- AAGTCCTCCCGTCCACAGG -3'
Posted On2019-10-17