Incidental Mutation 'R7512:Fam189a1'
ID582151
Institutional Source Beutler Lab
Gene Symbol Fam189a1
Ensembl Gene ENSMUSG00000030518
Gene Namefamily with sequence similarity 189, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7512 (G1)
Quality Score181.009
Status Validated
Chromosome7
Chromosomal Location64756091-65156570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65156170 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 52 (A52T)
Ref Sequence ENSEMBL: ENSMUSP00000116119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119118] [ENSMUST00000148459]
Predicted Effect probably damaging
Transcript: ENSMUST00000119118
AA Change: A52T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113680
Gene: ENSMUSG00000030518
AA Change: A52T

DomainStartEndE-ValueType
Pfam:CD20 34 199 4.9e-33 PFAM
low complexity region 243 259 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148459
AA Change: A52T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116119
Gene: ENSMUSG00000030518
AA Change: A52T

DomainStartEndE-ValueType
Pfam:CD20 34 162 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Sort1 T A 3: 108,326,007 probably null Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Fam189a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:Fam189a1 APN 7 64819842 missense probably damaging 1.00
IGL02567:Fam189a1 APN 7 64786731 missense possibly damaging 0.95
thick UTSW 7 64759368 nonsense probably null
R0612:Fam189a1 UTSW 7 64761801 missense probably benign 0.17
R0720:Fam189a1 UTSW 7 64819910 splice site probably benign
R1368:Fam189a1 UTSW 7 64819877 missense probably damaging 1.00
R1716:Fam189a1 UTSW 7 64776885 splice site probably null
R1840:Fam189a1 UTSW 7 64759195 missense probably benign 0.37
R1972:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R1973:Fam189a1 UTSW 7 64775768 missense possibly damaging 0.91
R2201:Fam189a1 UTSW 7 64759393 missense probably benign 0.01
R2230:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2232:Fam189a1 UTSW 7 64759222 missense probably damaging 0.97
R2340:Fam189a1 UTSW 7 64775817 missense probably benign 0.00
R4809:Fam189a1 UTSW 7 64776740 missense probably damaging 1.00
R4923:Fam189a1 UTSW 7 64767691 missense probably benign 0.00
R4928:Fam189a1 UTSW 7 64759368 nonsense probably null
R5556:Fam189a1 UTSW 7 64856209 missense probably damaging 1.00
R5852:Fam189a1 UTSW 7 64775831 missense probably damaging 1.00
R6169:Fam189a1 UTSW 7 64759399 missense probably benign 0.00
R7029:Fam189a1 UTSW 7 64759327 missense probably benign 0.00
R7455:Fam189a1 UTSW 7 64759413 missense probably benign 0.00
R7896:Fam189a1 UTSW 7 64776809 missense probably damaging 1.00
R7979:Fam189a1 UTSW 7 64776809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACTCCGGGCGCAACG -3'
(R):5'- CTCGGTGAGAGGAGCGCA -3'

Sequencing Primer
(F):5'- ACTTGGAAACTGCTAGCCG -3'
(R):5'- AGAGAGCTTGCGGGACGAGATGC -3'
Posted On2019-10-17