Incidental Mutation 'R7512:Gm12185'
ID582167
Institutional Source Beutler Lab
Gene Symbol Gm12185
Ensembl Gene ENSMUSG00000048852
Gene Namepredicted gene 12185
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7512 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location48904656-48992226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48915890 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 158 (I158K)
Ref Sequence ENSEMBL: ENSMUSP00000054351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]
Predicted Effect probably benign
Transcript: ENSMUST00000059930
AA Change: I158K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: I158K

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094476
AA Change: I158K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: I158K

DomainStartEndE-ValueType
Pfam:IIGP 27 389 1e-122 PFAM
Pfam:DLIC 43 98 3.2e-5 PFAM
Pfam:MMR_HSR1 63 187 6e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 8.9e-153 PFAM
Pfam:MMR_HSR1 474 615 2.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Slit1 T C 19: 41,600,635 Y1471C probably damaging Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Gm12185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gm12185 APN 11 48907222 missense probably benign 0.01
IGL00495:Gm12185 APN 11 48907861 missense probably damaging 0.99
IGL01763:Gm12185 APN 11 48915844 missense probably benign 0.07
IGL01919:Gm12185 APN 11 48908059 missense possibly damaging 0.90
IGL03388:Gm12185 APN 11 48908286 missense probably benign 0.01
IGL03404:Gm12185 APN 11 48908037 missense probably damaging 1.00
PIT4458001:Gm12185 UTSW 11 48907911 missense probably damaging 1.00
R0347:Gm12185 UTSW 11 48915182 missense probably benign 0.29
R0488:Gm12185 UTSW 11 48907839 missense probably damaging 1.00
R1168:Gm12185 UTSW 11 48915355 missense possibly damaging 0.60
R1223:Gm12185 UTSW 11 48907276 missense probably damaging 0.98
R1417:Gm12185 UTSW 11 48907842 missense probably damaging 1.00
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1519:Gm12185 UTSW 11 48907767 missense probably damaging 1.00
R1558:Gm12185 UTSW 11 48915435 missense probably damaging 0.99
R1630:Gm12185 UTSW 11 48907890 missense probably benign 0.31
R1758:Gm12185 UTSW 11 48908032 missense possibly damaging 0.82
R1793:Gm12185 UTSW 11 48915756 nonsense probably null
R1908:Gm12185 UTSW 11 48915404 missense probably benign 0.00
R1983:Gm12185 UTSW 11 48915356 missense probably benign 0.01
R3917:Gm12185 UTSW 11 48915933 missense probably benign 0.01
R3969:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R3970:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R4510:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4511:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4529:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4529:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4532:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4533:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4533:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4678:Gm12185 UTSW 11 48915540 missense probably benign 0.05
R5094:Gm12185 UTSW 11 48907548 missense probably benign 0.35
R5238:Gm12185 UTSW 11 48908217 missense possibly damaging 0.92
R5306:Gm12185 UTSW 11 48915555 missense probably benign 0.03
R5371:Gm12185 UTSW 11 48915739 missense probably benign 0.01
R5995:Gm12185 UTSW 11 48915713 missense probably benign 0.40
R6113:Gm12185 UTSW 11 48915340 missense possibly damaging 0.47
R6147:Gm12185 UTSW 11 48915890 missense probably benign
R6160:Gm12185 UTSW 11 48908428 nonsense probably null
R6247:Gm12185 UTSW 11 48915908 missense probably damaging 0.98
R6264:Gm12185 UTSW 11 48916175 missense probably benign 0.01
R6748:Gm12185 UTSW 11 48916296 missense possibly damaging 0.53
R6765:Gm12185 UTSW 11 48915704 missense probably benign 0.12
R6970:Gm12185 UTSW 11 48907912 nonsense probably null
R7028:Gm12185 UTSW 11 48908244 missense possibly damaging 0.80
R7033:Gm12185 UTSW 11 48915999 missense probably benign
R7609:Gm12185 UTSW 11 48916023 missense possibly damaging 0.82
R7673:Gm12185 UTSW 11 48907628 missense probably benign 0.45
Z1176:Gm12185 UTSW 11 48908086 missense not run
Z1177:Gm12185 UTSW 11 48916302 missense not run
Predicted Primers PCR Primer
(F):5'- TAAGAAGACTGGAGGCTCCTG -3'
(R):5'- GAAGAAGGTGCAGCTGCTTC -3'

Sequencing Primer
(F):5'- AGGCTCCTGCTGGAAACGTTC -3'
(R):5'- TGCAGCTGCTTCCACAG -3'
Posted On2019-10-17