Mutagenetix > Incidental Mutation

Incidental Mutation 'R7512:Masp1'

582179

Institutional Source

Beutler Lab

Gene Symbol

Masp1

Ensembl Gene

ENSMUSG00000022887

Gene Name

mannan-binding lectin serine peptidase 1

Synonyms

Crarf

MMRRC Submission

Accession Numbers

Genbank: NM_008555; MGI: 88492

Essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R7512 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23449417-23520815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 23470124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 642 (R642L)

Ref Sequence

ENSEMBL: ENSMUSP00000155665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089883] [ENSMUST00000229619]

AlphaFold

P98064

Predicted Effect

probably benign
Transcript: ENSMUST00000089883

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000229619
AA Change: R642L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	A	10: 82,292,635	L1514F	probably benign	Het
Abca8b	C	T	11: 109,938,449	A1395T	probably benign	Het
Ank3	A	G	10: 69,990,861	K1787E		Het
Atg2a	C	T	19: 6,260,076	A1763V	probably damaging	Het
Bdp1	T	C	13: 100,050,949	I1637V	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Camsap3	A	G	8: 3,598,740	T20A	probably benign	Het
Ccnt2	T	A	1: 127,802,294	S303T	possibly damaging	Het
Cdh3	C	T	8: 106,539,008	Q228*	probably null	Het
Col19a1	C	T	1: 24,317,707	G632R	probably damaging	Het
Dock2	A	C	11: 34,312,542	C938G	possibly damaging	Het
Dync1i1	G	T	6: 5,969,410	V412L	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Fam185a	G	A	5: 21,447,358		probably null	Het
Fam189a1	C	T	7: 65,156,170	A52T	probably benign	Het
Fcho1	A	G	8: 71,716,863	L133P	possibly damaging	Het
Galnt12	G	A	4: 47,108,406	R181H	possibly damaging	Het
Gen1	A	G	12: 11,260,976	V85A	possibly damaging	Het
Gm12185	A	T	11: 48,915,890	I158K	probably benign	Het
Gm4027	G	T	12: 87,621,981	E128*	probably null	Het
Gm5624	T	C	14: 44,561,855	R82G		Het
Grap2	A	C	15: 80,648,553	N307T	probably benign	Het
H6pd	A	G	4: 149,995,948	F147L	probably benign	Het
Haspin	A	T	11: 73,136,592	I557N	probably damaging	Het
Hectd4	A	T	5: 121,297,109	K961N	possibly damaging	Het
Helz2	A	G	2: 181,230,854	M2495T	probably benign	Het
Helz2	A	T	2: 181,235,600		probably null	Het
Impdh1	T	C	6: 29,207,169	I59V	probably benign	Het
Kcnn1	A	T	8: 70,854,649	L200Q	possibly damaging	Het
Kif5c	T	A	2: 49,700,965	H276Q	probably damaging	Het
Kntc1	T	C	5: 123,790,938	L1259P	probably damaging	Het
Krtap4-1	A	T	11: 99,628,033	C50*	probably null	Het
Lat2	T	A	5: 134,605,944	D114V	probably damaging	Het
Lrrc41	A	G	4: 116,092,994	T535A	possibly damaging	Het
Ly75	A	T	2: 60,334,563	V757D	probably damaging	Het
Morn3	A	G	5: 123,037,280		probably null	Het
Mpl	A	T	4: 118,448,892	I384N		Het
Mtmr14	C	T	6: 113,268,691	Q409*	probably null	Het
Nek1	T	A	8: 61,130,145	D1272E	probably benign	Het
Oit3	T	C	10: 59,438,894	Y28C	probably damaging	Het
Olfr1267-ps1	A	G	2: 90,085,696	I255T	possibly damaging	Het
Olfr204	T	A	16: 59,315,027	N127Y	probably damaging	Het
Olfr372	T	A	8: 72,058,523	I281N	probably damaging	Het
Pcdh15	T	C	10: 74,641,382	Y186H	possibly damaging	Het
Pcdhgb1	T	A	18: 37,682,365	D636E	probably damaging	Het
Pdgfra	A	T	5: 75,195,014	R1062*	probably null	Het
Pds5b	T	C	5: 150,788,342	F922L	probably damaging	Het
Pip5k1c	G	A	10: 81,315,119		probably null	Het
Ppp2r3a	T	C	9: 101,175,333	T226A	possibly damaging	Het
Ptprh	G	A	7: 4,571,781	T413I	possibly damaging	Het
Rora	C	A	9: 69,374,085	D382E	probably benign	Het
Sacs	T	A	14: 61,204,430	N1308K	probably benign	Het
Sgce	C	T	6: 4,707,192	D218N	possibly damaging	Het
Slc34a3	A	T	2: 25,232,241		probably null	Het
Slit1	T	C	19: 41,600,635	Y1471C	probably damaging	Het
Smarca2	G	T	19: 26,683,809	V935L	possibly damaging	Het
Smchd1	T	C	17: 71,381,369	N1298S	possibly damaging	Het
Sort1	T	A	3: 108,326,007		probably null	Het
Spata13	T	C	14: 60,751,777	L964P	probably damaging	Het
Trav7-6	C	A	14: 53,717,095	D47E	probably benign	Het
Ubap2l	A	G	3: 90,010,496	F864L	unknown	Het
Vmn2r102	C	T	17: 19,694,101	P643S	probably damaging	Het
Zfp112	T	A	7: 24,125,179	C195S	possibly damaging	Het

Other mutations in Masp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Masp1	APN	16	23458091	missense	possibly damaging	0.93
IGL00428:Masp1	APN	16	23476312	missense	probably damaging	1.00
IGL00432:Masp1	APN	16	23513851	missense	probably damaging	1.00
IGL02598:Masp1	APN	16	23459631	missense	probably benign
IGL02718:Masp1	APN	16	23476293	missense	probably damaging	1.00
IGL02947:Masp1	APN	16	23494726	missense	probably damaging	0.99
A4554:Masp1	UTSW	16	23454940	splice site	probably null
PIT1430001:Masp1	UTSW	16	23513944	missense	probably damaging	1.00
R0103:Masp1	UTSW	16	23458018	missense	probably damaging	1.00
R0505:Masp1	UTSW	16	23458138	missense	probably benign
R0630:Masp1	UTSW	16	23452419	missense	probably benign	0.01
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1339:Masp1	UTSW	16	23452467	missense	probably damaging	1.00
R1521:Masp1	UTSW	16	23494637	missense	probably damaging	1.00
R1588:Masp1	UTSW	16	23494654	missense	probably damaging	1.00
R1961:Masp1	UTSW	16	23452932	missense	probably damaging	1.00
R1986:Masp1	UTSW	16	23483461	missense	probably benign	0.01
R2080:Masp1	UTSW	16	23491959	missense	probably damaging	1.00
R2215:Masp1	UTSW	16	23452521	missense	possibly damaging	0.92
R2216:Masp1	UTSW	16	23492055	missense	probably benign	0.00
R2443:Masp1	UTSW	16	23476312	missense	probably damaging	1.00
R4934:Masp1	UTSW	16	23465076	missense	probably damaging	0.98
R5224:Masp1	UTSW	16	23494695	missense	probably damaging	1.00
R5340:Masp1	UTSW	16	23458108	missense	probably damaging	1.00
R5562:Masp1	UTSW	16	23465167	splice site	probably null
R5663:Masp1	UTSW	16	23452938	missense	possibly damaging	0.57
R5742:Masp1	UTSW	16	23454925	missense	probably benign	0.01
R5763:Masp1	UTSW	16	23496247	missense	probably damaging	1.00
R5898:Masp1	UTSW	16	23491927	missense	probably damaging	0.99
R6901:Masp1	UTSW	16	23513834	missense	probably damaging	0.99
R6987:Masp1	UTSW	16	23513915	missense	probably damaging	1.00
R7069:Masp1	UTSW	16	23452455	missense	probably benign	0.20
R7356:Masp1	UTSW	16	23470243	missense	possibly damaging	0.50
R7539:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R7810:Masp1	UTSW	16	23476318	missense	probably benign	0.01
R8026:Masp1	UTSW	16	23484406	missense	probably damaging	1.00
R8391:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R8438:Masp1	UTSW	16	23470403	missense	probably benign	0.38
R8475:Masp1	UTSW	16	23452531	missense	probably damaging	0.99
R8870:Masp1	UTSW	16	23496132	missense	probably damaging	1.00
R9052:Masp1	UTSW	16	23520600	start gained	probably benign
R9072:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9073:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9599:Masp1	UTSW	16	23452948	missense	probably benign	0.16
R9686:Masp1	UTSW	16	23496137	missense	probably damaging	1.00
X0065:Masp1	UTSW	16	23513969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGGAGACCTTTGTGTAGACTCC -3'
(R):5'- TCTACCAAGACCTGAGCCTG -3'

Sequencing Primer
(F):5'- GAGACCTTTGTGTAGACTCCATACAC -3'
(R):5'- ACCTGAGCCTGAAGGTCCAG -3'

Posted On

2019-10-17