Incidental Mutation 'R7512:Slit1'
ID582186
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Nameslit guidance ligand 1
SynonymsSlil1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7512 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41600257-41743665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41600635 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1471 (Y1471C)
Ref Sequence ENSEMBL: ENSMUSP00000025993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000099454] [ENSMUST00000166496] [ENSMUST00000169141]
Predicted Effect probably damaging
Transcript: ENSMUST00000025993
AA Change: Y1471C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020
AA Change: Y1471C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099454
Predicted Effect probably benign
Transcript: ENSMUST00000166496
AA Change: M1430V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020
AA Change: M1430V

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169141
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,292,635 L1514F probably benign Het
Abca8b C T 11: 109,938,449 A1395T probably benign Het
Ank3 A G 10: 69,990,861 K1787E Het
Atg2a C T 19: 6,260,076 A1763V probably damaging Het
Bdp1 T C 13: 100,050,949 I1637V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Ccnt2 T A 1: 127,802,294 S303T possibly damaging Het
Cdh3 C T 8: 106,539,008 Q228* probably null Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dock2 A C 11: 34,312,542 C938G possibly damaging Het
Dync1i1 G T 6: 5,969,410 V412L possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fam185a G A 5: 21,447,358 probably null Het
Fam189a1 C T 7: 65,156,170 A52T probably benign Het
Fcho1 A G 8: 71,716,863 L133P possibly damaging Het
Galnt12 G A 4: 47,108,406 R181H possibly damaging Het
Gen1 A G 12: 11,260,976 V85A possibly damaging Het
Gm12185 A T 11: 48,915,890 I158K probably benign Het
Gm4027 G T 12: 87,621,981 E128* probably null Het
Gm5624 T C 14: 44,561,855 R82G Het
Grap2 A C 15: 80,648,553 N307T probably benign Het
H6pd A G 4: 149,995,948 F147L probably benign Het
Haspin A T 11: 73,136,592 I557N probably damaging Het
Hectd4 A T 5: 121,297,109 K961N possibly damaging Het
Helz2 A G 2: 181,230,854 M2495T probably benign Het
Helz2 A T 2: 181,235,600 probably null Het
Impdh1 T C 6: 29,207,169 I59V probably benign Het
Kcnn1 A T 8: 70,854,649 L200Q possibly damaging Het
Kif5c T A 2: 49,700,965 H276Q probably damaging Het
Kntc1 T C 5: 123,790,938 L1259P probably damaging Het
Krtap4-1 A T 11: 99,628,033 C50* probably null Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lrrc41 A G 4: 116,092,994 T535A possibly damaging Het
Ly75 A T 2: 60,334,563 V757D probably damaging Het
Masp1 C A 16: 23,470,124 R642L probably damaging Het
Morn3 A G 5: 123,037,280 probably null Het
Mpl A T 4: 118,448,892 I384N Het
Mtmr14 C T 6: 113,268,691 Q409* probably null Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Oit3 T C 10: 59,438,894 Y28C probably damaging Het
Olfr1267-ps1 A G 2: 90,085,696 I255T possibly damaging Het
Olfr204 T A 16: 59,315,027 N127Y probably damaging Het
Olfr372 T A 8: 72,058,523 I281N probably damaging Het
Pcdh15 T C 10: 74,641,382 Y186H possibly damaging Het
Pcdhgb1 T A 18: 37,682,365 D636E probably damaging Het
Pdgfra A T 5: 75,195,014 R1062* probably null Het
Pds5b T C 5: 150,788,342 F922L probably damaging Het
Pip5k1c G A 10: 81,315,119 probably null Het
Ppp2r3a T C 9: 101,175,333 T226A possibly damaging Het
Ptprh G A 7: 4,571,781 T413I possibly damaging Het
Rora C A 9: 69,374,085 D382E probably benign Het
Sacs T A 14: 61,204,430 N1308K probably benign Het
Sgce C T 6: 4,707,192 D218N possibly damaging Het
Slc34a3 A T 2: 25,232,241 probably null Het
Smarca2 G T 19: 26,683,809 V935L possibly damaging Het
Smchd1 T C 17: 71,381,369 N1298S possibly damaging Het
Sort1 T A 3: 108,326,007 probably null Het
Spata13 T C 14: 60,751,777 L964P probably damaging Het
Trav7-6 C A 14: 53,717,095 D47E probably benign Het
Ubap2l A G 3: 90,010,496 F864L unknown Het
Vmn2r102 C T 17: 19,694,101 P643S probably damaging Het
Zfp112 T A 7: 24,125,179 C195S possibly damaging Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41650835 missense probably damaging 1.00
IGL00515:Slit1 APN 19 41624501 missense probably damaging 0.97
IGL00909:Slit1 APN 19 41602255 missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41602300 missense probably damaging 1.00
IGL01116:Slit1 APN 19 41606385 missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41611044 missense probably damaging 1.00
IGL01688:Slit1 APN 19 41729106 missense probably damaging 1.00
IGL01720:Slit1 APN 19 41634214 missense probably benign 0.01
IGL01925:Slit1 APN 19 41608378 missense probably damaging 0.98
IGL02008:Slit1 APN 19 41646140 missense probably damaging 0.99
IGL02312:Slit1 APN 19 41601680 missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41602237 missense probably damaging 1.00
IGL02542:Slit1 APN 19 41627248 missense probably damaging 1.00
IGL02559:Slit1 APN 19 41721085 missense probably benign 0.01
IGL02609:Slit1 APN 19 41602304 missense probably damaging 0.99
IGL02623:Slit1 APN 19 41651683 missense probably damaging 0.98
IGL02729:Slit1 APN 19 41603334 missense probably damaging 1.00
IGL03230:Slit1 APN 19 41729085 missense probably damaging 1.00
IGL03387:Slit1 APN 19 41603442 missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41624549 missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41611031 missense probably damaging 1.00
R0432:Slit1 UTSW 19 41743293 missense probably damaging 0.98
R0496:Slit1 UTSW 19 41608311 splice site probably benign
R0722:Slit1 UTSW 19 41608435 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1488:Slit1 UTSW 19 41608385 missense probably damaging 1.00
R1615:Slit1 UTSW 19 41650671 splice site probably benign
R1694:Slit1 UTSW 19 41637592 missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41603335 missense probably damaging 1.00
R1842:Slit1 UTSW 19 41721038 critical splice donor site probably null
R1844:Slit1 UTSW 19 41625573 missense probably damaging 1.00
R1940:Slit1 UTSW 19 41630776 missense probably damaging 1.00
R2087:Slit1 UTSW 19 41637483 missense probably benign 0.00
R2094:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2095:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2104:Slit1 UTSW 19 41602247 missense possibly damaging 0.69
R2305:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2972:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2973:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2974:Slit1 UTSW 19 41611016 missense probably benign 0.03
R3159:Slit1 UTSW 19 41604373 missense probably benign
R3752:Slit1 UTSW 19 41646967 critical splice donor site probably null
R4095:Slit1 UTSW 19 41608486 intron probably benign
R4282:Slit1 UTSW 19 41614417 missense probably benign
R4417:Slit1 UTSW 19 41614469 missense probably damaging 1.00
R4607:Slit1 UTSW 19 41616793 missense probably benign 0.10
R4729:Slit1 UTSW 19 41647020 missense probably damaging 1.00
R4756:Slit1 UTSW 19 41649013 missense probably damaging 1.00
R4764:Slit1 UTSW 19 41721044 nonsense probably null
R4849:Slit1 UTSW 19 41649544 missense probably benign 0.17
R4874:Slit1 UTSW 19 41729054 critical splice donor site probably null
R5581:Slit1 UTSW 19 41616663 critical splice donor site probably null
R5699:Slit1 UTSW 19 41625520 critical splice donor site probably null
R5888:Slit1 UTSW 19 41743296 missense probably damaging 1.00
R5906:Slit1 UTSW 19 41606374 missense probably damaging 1.00
R6176:Slit1 UTSW 19 41637595 missense probably damaging 1.00
R6277:Slit1 UTSW 19 41600509 missense possibly damaging 0.81
R6702:Slit1 UTSW 19 41614870 missense possibly damaging 0.95
R6860:Slit1 UTSW 19 41616715 missense probably benign 0.10
R7015:Slit1 UTSW 19 41629886 nonsense probably null
R7172:Slit1 UTSW 19 41634666 missense probably damaging 1.00
R7568:Slit1 UTSW 19 41601635 missense probably damaging 1.00
R7614:Slit1 UTSW 19 41634200 missense probably damaging 1.00
R7650:Slit1 UTSW 19 41629924 missense probably damaging 1.00
R7687:Slit1 UTSW 19 41650689 missense probably benign 0.03
R7732:Slit1 UTSW 19 41604408 missense probably benign 0.01
X0023:Slit1 UTSW 19 41601640 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTTCCAGGTAGCAGGCAG -3'
(R):5'- TCCCCAATTACACTGTGGCC -3'

Sequencing Primer
(F):5'- TAAGCGCCTATCTGTGCAAG -3'
(R):5'- AATTACACTGTGGCCCCGGG -3'
Posted On2019-10-17